Well, I've just gone through that rather large paper posted on the last page. All I can say is please read my above post about religion having to take scientific discovery and warp it around in order to fit it's claims. Anybody with a working knowledge of evolutionary science, biology, history, archeology, anthropology, really any of those disciplines will see some rather obvious problems. That being said, I'd need a note pad and about five cups of coffee to start listing them off, but if any of the pro-god folk would like to bring them out one on one for me I'd be happy to explain.

Or, as Casey has pointed out, what's the use? Let 'em believe, it doesn't hurt me any.

Here's a hypthetical situation though. We know life on earth has gone through something of the tune of 6 massive extinctions or castrophe periods. Say this happens again tomorrow, and very little life is left, but that whole evolution thing kicks in (even the most ardent god folk have to admit that evolution occurrs, no matter where you think life came from, even the Catholic church agrees with this) and some other sentient type of life becomes self aware enough to create language and culture, even religion. So will Jesus come back? I mean he is the guy right?

Or these things won't have souls right, even if they were equally intelligent as us? What if they believed they had some kind of soul? Is that it for God's involvement on planet earth since humans are gone? Will he just cook up a few more and start fresh? Seems like a waste eh? Of course if an extinction occurred it would be god's will right? And we can't understand god's will. We're not allowed, so don't bother to question anything that ever happens. It's just god's will. Geeze it's all so easy when you switch your brain off. Just don't question god or the bible, and claim that anything contrary to what the bible says is wrong or a lie despite evidence otherwise.

Rinse, and repeat.
 
Hey sephin, did you know we have about 98.5% of the same DNA as a chimpanzee? Well, probably you did, but think about it mate. No monkeys around right now are our direct ancestors, evolution doesn't work by one species jsut morphing into a new one over time and the old incarnation sudenly disappearing. Modern humans are the only humans around because our current form outcompeted and outsurvived all others. Just because we have primate origins doesn't mean those primates still exist, or that a currently existing monkey had to be one of our ancestors.

It's easy not believe in evolution when you don't understand the basic process, and don't try to tell me that you do, you clearly don't. You talk about evolving at a slower rate, as if there was a set rate of evolution or something. Evolution is simply biological changes that occurr over time in response to environmental change that makes certain traits more effective for survival. It isn't some kind of pre-programmed response or process, it just occurrs. You just revealed a whole lot about how much you actually understand, and as far as I am concerned have lost all credibilty in any debate in which science, and especially evolution, is even a factor.
 
Last edited:
Swank most Christion belive in mirco evolution not macro-evolution. We belive 2 dogs got off the arc we don't belive 500 breeds of dogs jumped out from under a rock.
 
Well, I've just gone through that rather large paper posted on the last page. All I can say is please read my above post about religion having to take scientific discovery and warp it around in order to fit it's claims. Anybody with a working knowledge of evolutionary science, biology, history, archeology, anthropology, really any of those disciplines will see some rather obvious problems. That being said, I'd need a note pad and about five cups of coffee to start listing them off, but if any of the pro-god folk would like to bring them out one on one for me I'd be happy to explain.
Bib brought them up. Are you going to address his claims?

Here's a hypthetical situation though. We know life on earth has gone through something of the tune of 6 massive extinctions or castrophe periods. Say this happens again tomorrow, and very little life is left, but that whole evolution thing kicks in (even the most ardent god folk have to admit that evolution occurrs, no matter where you think life came from, even the Catholic church agrees with this) and some other sentient type of life becomes self aware enough to create language and culture, even religion. So will Jesus come back? I mean he is the guy right?
Yes we all agree in microevolution (within species). Not that one single cell organism, over time evolved into what we are today. It is a mathematical impossibility, even in billions of years.

Your hypothetical situation will not happen according to the Bible. The next time the whole earth suffers a complete wipeout will be in fire, as it says in Revelations. If this mass extinction like you said occurs though, of course the Bible is wrong, and since one part is wrong I would disregard the whole thing. But then again, by then Id be dead :(

Or these things won't have souls right, even if they were equally intelligent as us? What if they believed they had some kind of soul? Is that it for God's involvement on planet earth since humans are gone? Will he just cook up a few more and start fresh? Seems like a waste eh? Of course if an extinction occurred it would be god's will right? And we can't understand god's will. We're not allowed, so don't bother to question anything that ever happens. It's just god's will. Geeze it's all so easy when you switch your brain off. Just don't question god or the bible, and claim that anything contrary to what the bible says is wrong or a lie despite evidence otherwise.

Rinse, and repeat.
Like I said, we know God's will about mass extinction by reading Revelation ;) I love when people expound on assumptions and hypotheticals.

You might not know God's exact will, but you can know God's heart (overall intentions), and you can read the Bible to figure most of it out.

Show me the evidence discrediting the Bible. Please do. I am always open to hear evidence refuting the Bible. Funny how the most popular things thrown at Christiniaty are the most absurd (aka The Da Vinci Code).

Hey sephin, did you know we have about 98.5% of the same DNA as a chimpanzee? Well, probably you did, but think about it mate. No monkeys around right now are our direct ancestors, evolution doesn't work by one species jsut morphing into a new one over time and the old incarnation sudenly disappearing. Modern humans are the only humans around because our current form outcompeted and outsurvived all others. Just because we have primate origins doesn't mean those primates still exist, or that a currently existing monkey had to be one of our ancestors.
I know about the % of DNA. Only thing you have done with this is turned the spotlight towards the fossil record. No missing links found yet. Maybe one day ;)

It's easy not believe in evolution when you don't understand the basic process, and don't try to tell me that you do, you clearly don't. You talk about evolving at a slower rate, as if there was a set rate of evolution or something. Evolution is simply biological changes that occurr over time in response to environmental change that makes certain traits more effective for survival. It isn't some kind of pre-programmed response or process, it just occurrs. You just revealed a whole lot about how much you actually understand, and as far as I am concerned have lost all credibilty in any debate in which science, and especially evolution, is even a factor.
Lol you are very funny my friend. I never said evolution was a set a time. Good taking what I say out of context in one sentence and spending the rest expounding on that ;)
 
BTW Richard Deem is the man. http://www.freerepublic.com/forum/a3b47d7b94f92.htm

Awesome read. Yet another intelligent writer slapping evolution in the face.

Descent of Man Theory: Disproved by Molecular Biology
by Richard Deem
Introduction
The current theory of human evolution states that modern humans evolved from more primitive bipedal hominids. The first bipedal hominid genus that is supposedly the ancestor of modern humans is Australopithecus, which appeared in the fossil record from about 4.4 to 1 million years ago throughout eastern Africa. Australopithecus comprised a diverse group of small-brained bipedal species that were confined to the savannas of Africa. This genus was supposed to have evolved into the genus Homo, which has been defined as bipedal primates with a brain capacity over 700 cc, having appeared in the fossil record by about 2 million years ago as Homo habilis in eastern Africa. According to theory, Homo habilis evolved into Homo erectus, which had a brain capacity just over 1000 cc, appearing in the fossil record from about 1.5 million to 300 thousand years ago. Homo neandertalensis lived between 400 and 28 thousand years ago. Archaic Homo sapiens appeared 400 - 150 thousand years ago, and modern Homo sapiens from less than 100 thousand years ago. Contrary to the claims of many creationists, there is ample evidence for the existence of human-like species of bipedal primates. The dates and ages of these fossils are not widely disputed in scientific circles. The reality of the fossil record and the reliability of the dates of these fossils is actually instrumental in disproving the descent of man theory. If the fossil record were not as complete as it now is, the standard evolutionist argument would apply, "we just haven't found the missing link ancestor of modern humans yet."

The beginning of trouble - lack of genetic diversity among modern humans
As evolutionists studied humans and species of apes in the 1970's and 1980's, some rather surprising information was being discovered that distinguished us from apes and other primates. The maximum Fst value (a measure of variation between population groups) between human races is 0.08 (1, 2). However, among populations of chimps, orangutans, and other primate species, Fst values are commonly more than 0.20. An examination of 62 common protein coding genetic loci, indicates a substitution rate of 0.011/locus (Caucasoids versus Mongoloids), to a maximum of 0.029 (Mongoloids versus Negroids). However, in nearly all other animal species studied, including apes, usually exceed 0.05 (2). In humans, heterozygosity (the proportion of alleles that are polymorphic, in this case within the species) is 1.8% , whereas in apes it ranges from 2.5 in the Orangutan to 3.9 in the Chimpanzee (3). An analysis of the genetics of populations of apes reveals that different population groups possess fixed novel mutations that characterize each population. In contrast, there are no novel mutations or genetic alleles that specifically characterize any one human race from another. More recent studies have confirmed the early work, likewise showing that human genetic diversity is far less than what one would predict from Darwinian theory. Dr. Maryellen Ruvolo (Harvard University) has noted, "It's a mystery none of us can explain." (4). Examinations of the genetic sequences of diverse modern human populations reveals minor, if any differences (5). All of this evidence suggested a recent origin for modern humans.

Still more trouble - Discontinuous morphological changes in the hominid lineage
Paleontological discoveries and geochronology show that the pattern of morphological change in the hominid fossil record was not progressive, but abrupt (6). Some adaptations essential to bipedalism appeared early, but others appeared much later. Although the 3.2 million year old fossil "Lucy" (Australopithecus afarensis), was said to be bipedal, her 2.6 million year old descendent, Australopithecus africanus, was indisputably arboreal (7). Primitive craniodental complexes (similar to the reconstructed last common ancestor with the African great apes) were found in nearly all species of Hominidae (8). Relative brain size increased slightly among successively younger species of Australopithecines, although many Australopithecine skulls have brain capacities no larger than those of chimpanzees. (9, 10). However, brain capacities expanded abruptly with the appearance of Homo, but within early Homo remained at about half the size of Homo sapiens for almost a million years. The fossil record indicates an accumulation of relatively rapid shifts in successive species, and certainly not any kind of gradualistic changes.

Another problem - too many deleterious mutations
A recent study examined the mutation rate for humans. Using "conservative assumptions" the authors found that the overall mutation rates was 4.2 mutations per person per generation, with a deleterious rate of 1.6 (11). When using more realistic assumptions the overall mutation rate for humans become 6.7 with a deleterious rate of 3.1. Such a high rate should have resulted in extinction of our species long ago. They stated in their conclusion:

"The deleterious mutation rate appears to be so high in humans and our close relatives that it is doubtful that such species, which have low reproductive rates, could survive if mutational effects on fitness were to combine in a multiplicative way."

The authors had to rely upon a rare association of mutations, termed synergistic epistasis to explain why the numerous hypothesized deleterious mutations have not overwhelmed our genome. Instead of postulating the obvious (that the human genome is not as old as evolution would teach), evolutionists must rely upon the improbable to retain the evolutionary paradigm.

Recent origin of modern humans confirmed through molecular biology
Mitochondrial DNA (mtDNA)
In the late 1980's and early 1990's a number of studies were done examining the mitochondrial DNA (mtDNA) of women all over the world. These studies, nicknamed the "Eve theory," suggested that the last common ancestor of modern man (actually women) appeared within the last 200,000 years (12-15), much more recently than previously thought. Refinements in the measurements lowered the original estimates to 135,000 years (15) and finally 100,000 years (19). Scientists chose to examine mtDNA because, being enclosed within the subcellular organelle called the mitochondrion, there is no genetic recombination (males make no contribution of mtDNA to the fetus). All mtDNA comes from our mothers and is passed down from mother to daughter, since only mitochondria from the egg are used to make up the fetus. By tracing the differences in mtDNA from peoples around the world, scientists have calculated the probable date of the last common ancestor of modern humans at 100,000 to 200,000 years ago.

Y-chromosome analysis
In 1995, scientists have examined human origins from the perspective of male genetics (16, 17). Scientists have examined a gene (ZFY), which being on the Y chromosome, is passed down only from father to son. Thirty-eight men were chosen from all over the world (Africa, Asia, Australia, Europe, and Northern, Central, and South America). Scientists determined the actual genetic sequence in each man for this gene, which is 729 base pairs long. To their surprise, all men had identical genetic sequences (over 27,000 base pairs analyzed). Scientists have calculated the most probable date for the last common ancestor of modern man, given the sequence diversity from modern apes. Using two different models this date is either 270,000 or 27,000 years ago. However, both these models assume that the male population during this entire period of time consisted of only 7,500 individuals. The date estimates from these models would be significantly reduced if the male population were higher than 7,500, which is very likely. Two separate studies using similar techniques looked at larger pieces of the Y chromosome, which would reduce the uncertainty in the calculation of dates. One study examined a gene which was 2,600 base pairs and determined a last common ancestor date of 188,000 year ago (minimum of 51,000 and maximum of 411,000 years ago) (18). The other study used a very large piece of the Y chromosome (18,300 base pairs) and calculated a last common ancestor date of modern man of 43,000 years ago (minimum of 37,000 and maximum of 49,000 years ago) (19). This latter study also examined mitochondrial DNA from women and determined an origination date of 90,000-120,000 years ago.

Linkage disequilibrium analysis
A studied published in 1996 (20) examined linkage disequilibrium at the human CD4 locus (a T-cell associated antigen) as a means to establish the date of modern human origins. This study determined a maximum origin date of 102,000 years ago based upon the assumption that the Alu (-) allele arose 5 million years ago, or almost immediately after mankind's split from other primates. As they stated, "It is likely that the Alu deletion event occurred more recently, in which case our estimates for the date of founding of the non-African populations would also be more recent." Preliminary studies from chromosomes 19, 11 and 8 show similar results to that seen on chromosome 12 (the locus of the CD4 gene) (21).

Using rare mutations to estimate population divergence times
A study published in December, 1998 examined population divergence time using rare mutations between populations to estimate divergence among three Mediterranean populations. The results indicated that Danish people (who are my ancestors) would have diverged from the other groups, at most, 4,500 to 15,000 years ago (22). This number does not necessarily help us establish a date for the appearance of modern humans, but it is likely that future studies in this area (this is one of the first published) may provide accurate numbers for the appearance of human populations in different areas of the world and a lower limit to the date of appearance of modern humans.

The nail in the coffin
Therefore, the most accurate date (see note below) for the origin of modern humans indicate that the last common ancestor to modern humans must have existed less than 50,000 years ago (19). Such a recent date left only one potential ancestor for modern humans, that is, Homo neandertalensis (Neanderthals), which lived between 400,000 and 28,000 years ago. Previous anatomical studies had cast doubt on the possibility of Neanderthals being the ancestors of modern humans (23-26). These studies showed differences in Neanderthal's brain case (23) and the presence of an internal nasal margin, a medial swelling of the lateral nasal wall, and a lack of an ossified roof over the lacrimal groove (24-25). None of these features are found in Homo Sapiens, and the last feature is not found in any other terrestrial mammal! Neanderthals had a huge nasal cavity coupled with a brain size larger than our own. However, with their carnivorous lifestyle, it seems likely that much of their brain might have been devoted to the sense of smell, being the "dog" among the hominids.

In brilliantly designed and executed independent studies, scientists have extracted mtDNA from three Neanderthal skeletons; one from Neander Valley in Germany, another from the northern Caucasus near the Black Sea, and the third in Vindija Cave, Croatia, and laid to rest any question of whether Neanderthals could have been our ancestors (27, 28, 29). The first study examined a 397 base pair Neanderthal mtDNA fragment and compared it with a mtDNA sequence of 986 nucleotide pairs from living humans of diverse ethnic backgrounds. The results (Table 1) showed an enormous 26 nucleotide base pair difference between the Neanderthal and Human mtDNA (a 6.5% difference) (30). In this region of the mtDNA, modern humans differ from one another in an average of eight base pairs, and those differences were completely independent of the 26 observed for the Neanderthal fossil. However, many of the sequence variations found in the Neanderthals were shared in the Chimpanzee. A 357 base pair sequence of mtDNA was examined from the second Neanderthal fossil and was found to vary from modern human sequences at 23 bases (6.4%), nineteen of which were identical to those of the first Neanderthal. The third Neanderthal differed from modern humans by 26 bases, 23 of which matched the first Neanderthal and 20 of which matched the second specimen. A summary of the findings of the two studies can be found in Table 1, below.

Table 1. Sequence Differences* Between Modern Humans and Neanderthals
mtDNA Sample
(HVR-1) Sequence Number (Read Down)
111111111111111111111111111111111
666666666666666666666666666666666
000011111111111112222222222223333
378900112345568880233455666791246
786378129984692399304468123891042

Modern Human AATTCCCCGACTGCAATTCACGCACC-CATCCT
Chimpanzee ......T.ATT.....ACTGAAA.....G....
Neanderthal #1 GG.CTTTTATTC.T.CCCTGTAAG.TATGCT.C
Neanderthal #2 .C.....ATT.ATCCCCTGTAA..TATGCTTC
Neanderthal #3 GG......ATTC.TCCCCTGTAAG.TATGCT.C
*mtDNA HVR-1

The analysis of the second sample was extremely important, since it was dated at 29,000 years ago - only 1000 years before the last Neanderthal disappeared (31). If Neanderthals and humans had interbred, one should have expected to see this in the last remnants of the Neanderthals. In addition, since the Neanderthal fossils were separated geographically by over 2,500 km, it shows that Neanderthals were a homogeneous species. The researchers conclusion: "Neanderthals were not our ancestors" - a quote from the authors of the first study. In fact, the differences between modern humans and Neanderthals were so great that calculations indicated that the last common ancestor (according to evolutionary theory) must have existed 550,000 to 690,000 years ago (first study) and 365,000 to 853,000 years ago (second study).

Although the differences between modern humans and Neanderthals are large, the differences among individual humans or among individual Neanderthals is small compared to other apes (Table 2). Such low genetic diversity among Neanderthals are consistent with a creation model in which Neanderthals were specially created as a small population in the relatively recent past. The much larger variation seen among chimpanzees and gorillas does not eliminate them as specially created, but does place their probable creation date considerably before that of modern humans.

Table 2. mtDNA Sequence Variation Among Species (29) Population Individuals Mean Minimum Maximum s.d.
Neanderthals 0,003 03.73 - - -
Humans 5,530 03.43 0.00 10.16 1.21
Chimpanzees 0,359 14.81 0.00 29.06 5.70
Gorillas 0,028 18.57 0.40 28.79 5.26

Ancient Anatomically Modern Humans - the missing evidence
Knowing the variation of sequences between modern humans and Neanderthals is important in determining if Neanderthals contributed to the human gene pool. However, without a measure of the variation among ancient anatomically modern humans and between them and modern humans, the data is incomplete. The first of these studies was published in 2001, examining the mtDNA sequences of 10 ancient Australians (32). A summary of the HVR-1 sequence of these individuals (compared with the modern human reference sequence, modern Aboriginal polymorphism, Neanderthals, and chimpanzees) can be found in Table 3, below. The first thing that one notices is that the sequence variation of ancient humans compared to modern humans is at most 10 base pairs (in LM3, the most ancient specimen). As stated previously, the average variation among population groups of modern humans is 8 base pairs. LM3, dated at 62,000 years old, varied the most from the modern human reference sequence, but this variation included only three bases shared with Neanderthal specimens. Since LM3 was a contemporary (or lived even earlier than the Neanderthals sequenced to date), it is apparent that the human genome was already nearly "modern" before Neanderthals died out. The authors of the study made a big deal about the LM3 sequence sharing similarity to a portion of chromosome 11 in modern humans (thought to have been inserted into the human genome from the mtDNA). The authors concluded that the "loss" of the ancient mtDNA variation seen in LM3 could explain how Neanderthals do not share mtDNA with modern humans. Although it is certainly possible that part of mtDNA might find its way into the nuclear genome, it doesn't address the issue of how the variation seen in the mtDNA of LM3 was "lost." In fact, of the ten sequence differences between LM3 and the modern human reference sequence, five of those bases correspond to polymorphisms found in modern Aboriginal people, showing that those five bases were not lost at all. This leaves only a five base difference, certainly within the range of that found among modern humans. Overall, the lack of "evolution" for humans over the last 60,000 years stands in sharp contrast to the large differences seen between modern humans and Neanderthals. European evolutionists have also disputed the claims of Adcock et al. in the journal Science in June, 2001. More information on this can be found in the paper, New DNA Evidence Supports Multiregional Evolutionary Model?

Table 3. mtDNA Sequence Variation of Ancient, Anatomically Modern Humans (32) mtDNA Sample
(HVR-1) Age
(ka) Sequence Number (Read Down)
00111111111111111222222222222222222222222222233333333333333
79001122345668889001223344444555566677888899901112345556688
83781269984393499198340413479368923448467803911780715672817

Modern Human 0 ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA
Aboriginal 0 ......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C...
Bonobo 0 ......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC..
Chimpanzee 0 ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C..
Neanderthal #1 30+ GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C...
LM3 62 ....................T.G...........CT.T....T..T......TC....G
LM4 <10 .................T...........G................C............
LM15 0.2 ....................T........................T.......C....G
LM55 <10 ...........G.......................T.......................
KS1 10 .C............T.....T.........................CG..T........
KS7 8 ..............T.....T..................T...........C.......
KS8 8-15 ....................T.G..............TG.......C............
KS9 9 .C..................T..............T............C.........G
KS13 8-15 .C............T.....T....C.G.................TC............
KS16 9-15 ....................T...................T.............C..C.
*mtDNA HVR-1



The bottom line
There are two currently popular theories of human evolution 1) a single recent appearance of modern humans and 2) the multiregional model, which states that modern humans evolved simultaneously on different continents. Molecular biology destroys the multiregional model (12-22, 27-32). In addition, even the fossil evidence does not support the multiregional model (33). Instead, all the data supports the biblical view that humanity arose in one geographical locale. Modern molecular biology tells us that modern humans arose less than 100,000 years ago (confirmed by three independent techniques), and most likely, less than 50,000 years ago (12-22). This data ties in quite well with the fossil record. Sophisticated works of art first appear in the fossil record about 40,000-50,000 years ago (34) and evidence of religious expression appears only 25,000-50,000 years ago (35, 36). Other indications of rapid changes during the Middle-Upper Paleolithic transition (35, 000 to 45, 000 years ago) in Europe include (37):

A shift in stone tool technology from predominantly "Rake" technologies to "blade" technologies, achieved by means of more economic techniques of core preparation.
A simultaneous increase in the variety and complexity of stone tools involving more standardization of shape and a higher degree of "imposed form" in the various stages of production.
The appearance of relatively complex and extensively shaped bone, antler, and ivory artifacts.
An increase in the rate of technological change accompanied by increased regional diversification of tool, forms.
The appearance of beads, pendants, and other personal ornaments made from teeth, shell, bone, stone, and ivory blanks.
The appearance of sophisticated and highly complex forms of representational or "naturalistic" art.
Associated changes in the socioeconomic organization of human groups, marked by
a more specialized pattern of animal exploitation, based on systematic hunting
a sharp increase in the overall density of human population
an increase in the maximum size of local residential groups
the appearance of more highly "structured" sites, including more evidence for hearths, pits, huts, tents, and other habitations.
Simultaneous, rapid changes in human abilities suggest replacement of previously existing hominids with modern humans. The fact that all these events happened ~50,000 years ago precludes any possibility that previously existing hominids could be our ancestors, since Homo erectus died out 300,000 years ago, and Homo neandertalensis has been proven to be too genetically different from us to have been our ancestor (27, 28). Where does this leave the evolutionists and their descent of man theory? Well, they can always fall back on their favorite line - "the fossil record is just incomplete." Alternatively, check out Genesis 1:26.


--------------------------------------------------------------------------------

References
R. Lewontin 1972. The apportionment of human diversity. Evolutionary Biology 6: 381-398
M. Nei and A. K. Roychoudhury. 1982. Genetic relationship and evolution of human races. Evolutionary Biology 14: 1-59
Janczewski DN. Goldman D. O'Brien SJ. 1990. Molecular genetic divergence of orangutan (Pongo pygmaeus) subspecies based on isozyme and two-dimensional gel electrophoresis. Journal of Heredity 81: 375-387
Gibbons, A. 1995. The mystery of humanity's missing mutations. Science 267: 35-36.
Pult I, Sajantila A, Simanainen J, Georgiev O, Schaffner W, Paabo S. 1994. Mitochondrial DNA sequences from Switzerland reveal striking homogeneity of European populations. Biol Chem Hoppe Seyler 375: 837-840
Wood B. 1992. Origin and evolution of the genus Homo. Nature 355: 783-790.
Shreeve, J. 1996. New skeleton gives path from trees to ground an odd turn. Science 272: 654
McHenry H.M. 1994. Body size and proportions in early hominids. Proceedings of the National Academy of Sciences of the United States of America 91: 6780-6786.
Dean Falk. 1998. Hominid brain evolution: looks can be deceiving. Science 280: 1714
Conroy, G.C., G.W. Weber, H. Seidler, P.V. Tobias, A. Kane, and B. Brunsden. 1998. Endocranial capacity in an early hominid cranium from Sterkfontein, South Africa. Science 280: 1730-1731.
Eyre-Walker, A. & Keightley, P. D. 1999. High genomic deleterious mutation rates in hominids. Nature 397, 344-347.
R.L. Cann, M. Stoneking, A.C. Wilson. 1987. Mitochondrial DNA and human evolution. Nature 325: 31.
L. Vigilant, M. Stoneking, A.C. Harpending, K. Hawkes, A.C. Wilson. 1991. African populations and the evolution of human mitochondrial DNA. Science 253: 1503.
M. Hasegawa, S. Horai. 1991. Time of the deepest root for polymorphism in human mitochondrial DNA. J. Mol. Evol. 32: 37.
Stoneking M, Sherry ST, Redd AJ, Vigilant L. 1992. New approaches to dating suggest a recent age for the human mtDNA ancestor. Philos. Trans. R. Soc. Lond. B Biol. Sci. 337: 167-175.
S. Paabo. 1995. The Y chromosome and the origin of all of us (men). Science 268: 1141.
R.L. Dorit, H. Akashi, W. Gilbert. 1995. Absence of polymorphism at the ZFY locus on the human Y chromosome. Science 268: 1183.
Hammer, M.F. 1995. A recent common ancestry for human Y chromosomes. Nature 378: 376-378.
Whitfield, L.S., J.E. Suston, and P.N. Goodfellow. 1995. Sequence variation of the human Y chromosome. Nature 378: 379-380.
Tishkoff, S.A., E. Dietzsch, W. Speed, A.J. Pakstis, J.R. Kidd, K. Cheung, B. Bonn-Tamir, A.S. Santachiara-Benerecetti, P. Moral, M. Krings, S. Paabo, E. Watson, N. Risch, T. Jenkins, and K.K. Kidd. 1996. Global patterns of linkage disequilibrium at the CD4 locus and modern human origins. Science 271: 1380-1387.
FiscHydromaxan, J. 1996. Evidence mounts for our African origins - and alternatives. Science 271: 1364.
G. and B. Rannala. 1998. Using rare mutations to estimate population divergence times: A maximum likelihood approach. Proceedings of the National Academy of Science USA 95: 15452-15457.
Seidler H, Falk D, Stringer C, Wilfing H, Muller GB, zur Nedden D, Weber GW, Reicheis W, and Arsuaga JL. 1997. A comparative study of stereolithographically modeled skulls of Petralona and Broken Hill: implications for future studies of middle Pleistocene hominid evolution. J. Hum. Evol. 33:691-703.
Schwartz, J.A. and I. Tattersall. 1996. Significance of some previously unaccompanied apomorphies in the nasal region of Homo neandertalensis. Proceedings of the National Academy of Science USA 93: 10852-10854.
Laitman, J.T., J.S. Reidenberg, S. Marquez, and P. J. Gannon. 1996. What the nose knows: New understandings of Neanderthal upper respiratory tract specializations. Proceedings of the National Academy of Science USA 93: 10543-10545.
Holden, C. 1999. A New Look Into Neandertals' Noses. Science 285: 31-33.
Krings, M., A. Stone, R. W. ScHydromaxitz, H. Krainitzki, M. Stoneking, and S. Paabo. 1997. Neandertal DNA Sequences and the Origin of Modern Humans. Cell 90: 19-30.
Igor V. Ovchinnikov, I.V., A. Gotherstrom, G. P. Romanovak, V. M. Kharitonov, K. Liden, and W. Goodwin. 2000. Molecular analysis of Neanderthal DNA from the northern Caucasus. Nature 404: 490-493.
Krings, M., C. Capelli, F. Tschentscher, H. Geisert, S. Meyer, A. von Haeseler, K. GrossscHydromaxidt, G. Possnert, M. Paunovic, and S. P””bo. 2000. A view of Neandertal genetic diversity Nature Genetics 26: 144-146.
Arnason, U., X. Xu, and A.Gullberg. 1996. Comparison between the complete mitochondrial DNA sequences of Homo and the common chimpanzee based on nonchimeric sequences. J. Mol. Evol. 42: 145-52.
Stringer, C. B. and R. Mackie. 1996. African Exodus: the Origin of Modern Humanity. Cape, London.
Adcock, G.J., E.S. Dennis, S. Easteal, G.A. Huttley, L.S. Jermiin, W.J. Peacock, and A. Thorne. 2001. Mitochondrial DNA sequences in ancient Australians: Implications for modern human origins. Proceedings of the National Academy of Science USA 98: 537-542
Foley R. 1998. The context of human genetic evolution. Genome Res 8:339-347.
Klein, R.G. 1992. Evolutionary Anthropology 1: 5-14.
Balter, M. 1999. Restorers reveal 28,000-year-old artworks. Science 283: 1835.
Simon, C. 1981. Stone-age sanctuary, oldest known shrine, discovered in Spain. Science News 120: 357.
Bower, B. 1986. When the human spirit soared. Science News 130: 378-379.
Clark, G.A. 1999. Highly visible, curiously intangible. Science 283: 2029-2032.

--------------------------------------------------------------------------------

Note:
The 50,000 year date is the best estimate for modern human origins because the study used a much larger nucleotide base pair sample size, resulting in a much less uncertainty in the date generated (see the table below for further explanation).

95% confidence interval
Study Model # base pairs # men Total base pairs Lower Upper Mean Male population size
Dorit, et al. Coalescent 729 38 27702 0 800,000 270,000 7,500
Dorit, et al. Star phylogeny 729 38 27702 0 80,000 27,000 7,500
Hammer Coalescent 2,600 15 39,000 51,000 411,000 188,000 5,000
Whitfield, et al. Coalescent 18,300 5 91,500 37,000 49,000 43,000 not given
The estimate of modern origins is highly dependent upon the assumed population size (last column of table). The first study assumed a male population size of 7,500 individuals for the entire period of humanity (excluding the last couple thousand years, of course). Such a population size, according to the authors, is "an exceedingly small population size for this entire 300,000 year period" (16). However, such as small population size was necessary to make the coalescence time as large as it was. Hammer used an even smaller population size (5,000), since he was concerned that his study would not be accepted if the coalescence time was too small (which he admitted to doing in Internet dialogs). The first two studies (Dorit, et al. and Hammer) have very large confidence intervals, due to the small number of nucleotide base pairs analyzed. Given the size of the confidence intervals in the first two studies, the numbers from all three studies are basically the same. Obviously, the Whitfield, et al. gives the most precise estimate of the date for the appearance of modern humans.
 
Do you think dodging all the facts I have presented, long-winded or not does anything for you ;)?

You simply refuse to even read anything I put forth. You might pick out 1-2 quotes you can misquote or go off on, getting away from the main debate. *shrug* I'm done here. The Bib and Deem articles are where the facts are at, and you dodge both.

Ah well. Did my best, but you cant reason with people that refuse to look at the logic. As many of these threads go. My opposition posts little facts and when they do many have little relation to the topic. Have fun with all your opinions ;)
 
Sephin - your whole post leads me to believe that you don't understand a bloody thing about evolution:

**Lol this is the easiest statement to refute. Come on, I am sure 5th graders learn to regulate on this, in Sunday School.

If evolution goes toward the most advanced form, and from Monkey to Man, Man is it.

Why are monkeys still around? Are some evolving at a slower rate? If so, where are the in between forms? The missing links never found?

The only "missing links" so far were either complete monkey, complete man, or it was a farce.

If monkeys (not monkees ) are still around today and so are humans, then so should the inbetween forms. Since they are not, this completely disproves the relation. **

Evolution does not favor the most advanced form, only change. Complexity is not a dependent in the evolutionary process. Evolution favors whatever works best in the species environment - not complexity. This is fundamental to the theory and clearly beyond you.

Why are monkies still around? Are you nuts? Why wouldn't they be around? Because we are around all types of primates ought to be extinct? Once again, you have demonstrated with amazing gusto that you have absolutely no actual understanding of evolutionary theory.

No missing links? Ever hear of Lucy? There are tons of fossils of creatures that are neither strictly apre nor man, and more continue to be found. This whole 'there is no missing link' argument is hilarious. What will satisfy you people? Here's a question, how many times can you split an angle - it's rechinically infinate. How man more skeletons that are neither modern homosapien nor more primitive ape to anthropoligsts have to find and show you people before you realize there are middling life forms between modern human and ape?

I'm really chuckling over here . . . you can't be argued with my friend - why should I even discuss something with you that you don't have any basic understanding of in the first place?
 
So god created earth and created us in his own image... So then howcome god made dinosaurs first? was he saving the best for last?

I want dinosaurs back they were cool looking.
 
Imagine dinosaurs living with humans today.. man oh man.

George bush mounting a couple guns on a T-Rex and strolling into IRAQ.. HAHAHAHA
 
Casey said:
This is like trying to reason with an eighty year old man, or a 5 year old child. No matter what the facts are, they will never concede and change their mind. So whats the point? Let them believe their religion. In a hundred years, i bet religion will almost die out. At least in the US. I wish an actual scientist was here, so they could blow all this creation crap outta the water. There is NO debate among most scientists about evolution. This is just politically motivated, religious dogma.

Religion fuels the support for Prez Bush. All his religious references and open religious crusades make people think he's sent by god. I heard a Bushie say to the Prez, "this is the 1st time I've felt like GOD is in the White House" and the crowd erupted in a standing appluase. How can you debate someone who thinks they are on god's side and your not? You cant win with that kind of stubborness. You cant compete with god, or what they think is god. Just look at LongTom's answer to #4 right above me. "You let God do it". Wow tom thats great for fantasy land, but this is real life. Hey god, I just got fired, can you get me a new job? Thanks, your the best god.

Oh and just curious, Sephin, how old are you and what part of the country do you come from?
You know everything you just said about Christians can be applied to you as well, so quit acting so fucking 'holier than thou' (pun intended). I don't know why you jackasses think that just because you are faithless that you are some kind of elightened genius and Christians live in the dark ages. The plain and simple truth is science has no better facts to prove where we come from tha Christians or any other religion. What's the difference in your theories and our theologies? Neither are provable. I don't understand why you are so damned hell-bent (another pun) on writing off Christians as idiots.

AC, I have always appreciated your posts here, but I am sick of your pretension in this post. It's one thing to tell us what you believe; it's another to make us out as stupid for what we believe. You see things in one light we see them differently, obviously, so why the hell do you insist on acting better than me (yes, I am starting to take this personally)?

And, no, there's not much debate on the evolution theory in the scientific community-- not because it's accepted as fact, but because scientiets are all scurrying around trying to be the first to actually come up with some credible evidence to prove it... so they can get their name in print right beside Charles Darwin of all people. And because they don't believe in God (they're too "smart" for that) and evolution is the best explanation theory they have.

Yeah, science is great if it actually prove something, but science hasn't proven shit as far as explaining creation, so that just makes these theories exercises of faith in their own right.

I am sick of this shit. I am gonna back to pulling on my dick and you all can go to hell. Literally if you choose. I know you all are gonna have some snide, yet super-intelligent comment to make about but I don't give a fuck anymore because your posts are a waste of my time.
 
Texan said:
You know everything you just said about Christians can be applied to you as well, so quit acting so fucking 'holier than thou' (pun intended). I don't know why you jackasses think that just because you are faithless that you are some kind of elightened genius and Christians live in the dark ages. The plain and simple truth is science has no better facts to prove where we come from tha Christians or any other religion. What's the difference in your theories and our theologies? Neither are provable. I don't understand why you are so damned hell-bent (another pun) on writing off Christians as idiots.

AC, I have always appreciated your posts here, but I am sick of your pretension in this post. It's one thing to tell us what you believe; it's another to make us out as stupid for what we believe. You see things in one light we see them differently, obviously, so why the hell do you insist on acting better than me (yes, I am starting to take this personally)?

And, no, there's not much debate on the evolution theory in the scientific community-- not because it's accepted as fact, but because scientiets are all scurrying around trying to be the first to actually come up with some credible evidence to prove it... so they can get their name in print right beside Charles Darwin of all people. And because they don't believe in God (they're too "smart" for that) and evolution is the best explanation theory they have.

Yeah, science is great if it actually prove something, but science hasn't proven shit as far as explaining creation, so that just makes these theories exercises of faith in their own right.

I am sick of this shit. I am gonna back to pulling on my dick and you all can go to hell. Literally if you choose. I know you all are gonna have some snide, yet super-intelligent comment to make about but I don't give a fuck anymore because your posts are a waste of my time.

:O...

This is my last post in this thread, I will sit back and watch. I may pull out my umbrella incase things get messy.
 
AncientChina said:
Another fact that needs to be stated.

A pro-christian started this thread and this debate, to even speak of being able to explain the universe and the bible itself is going to get a debate going by opposing forces. It was not simply Christians being disrespected, you start a debate on ideology and Christianity, if you try to force feed us irrelevent information then expect a debate because you know it's going to occur.

As for some of your post Texan, I don't have a super intelligent snide comment, but I do wonder why you are telling us to go to hell, it seems a little overly done. We are having a debate it's not supposed to be a emotional release of some kind. What is it that we are saying is supposed to be insulting to you? ?:(
Alright AC, I said I was done here, but out of respect for you I'm posting in this thread again only to say...

You are right in that this tread was a BAD idea and yes it was started by a Christian. I accept your apology, but many of your comments I interpreted as replies to sephin with broad implications to all Christians... comments like offering Kit-Kats to Ethiopians if they change their religion are uncalled for. Has it been done? Probably so, sad to say? Did Mendel cut up Jews for the sake of science? Yep. Does that make all scientists bad? No.

A lot of your comments were followed by laughing smilies, which I found distatseful. As for what Sephin or any other Christian said that was an inflamatory attack on you-- well, that is not right either.

Yeah, the 'go to hell' comment was harsh, but like I said, I took a lot of the things said here personally-- they went outside the ring of scholarly debate, definitely beyond friendly debate, in my opinion, and I took your comments the most personally because I have been reading your posts and interacting with you here for long enough to know that your comments are generally logical, pointed and exacting. Again, apology accepted, but I don't care to read about how stupid people are anymore-- scientists or Christians.
 
Last edited:
AncientChina said:
While revisiting my posts I agree, and I do apolgize again on that point. My post should have been much more clearer and well thought out, and I do feel that I did go a few points below my usual respectability in some of my replies and in my use of emoticons. For that I will apologize for and I am sorry that I lost a bit of your respect, and possible forever.

My kit-kat comment was my rebuttal to Sephin making the claim that all people need to hear the word of God, and God has thus instructed man to tell others, and I myself took offense to the fact that one religion would deem itself as the upmost importance to then push its views on those that know nothing of Jesus and have their own religion. The Kit Kat story was an attempt at a bit of comedy that may have fallen flat with some. I was not trying to say that all Christians were to do that, but I failed to make my conclusion clear, so yes that was my fault. My laughing smiles were not jeers at the opposing party, but general laughing at the situation, but again I see your point and you are correct on that assumption.

I have learned these debates often bring forward very little, in terms of agreement. I still agree with my points, but my execution (way I presented them) of those in this thread could have been much better in manner were simply executed poorly. I apologize for that, I see flaws in my execution here also, it was a personal forum posting low point for myself.

I will quietly step out of this debate. :) I appreciate the insight Texan, keeps me more aware of my actions and mindset.
Aww shit AC... now I feel bad. I probably misinterpreted your posts and jumped the gun a little. I apologize as as well, and I appreciate your contriteness. I hope all mutual respect remains intact. I should have kept my mouth shut and let it go. Anyway, I'm gonna leave this alone, as well...
 
Texan said:
Yeah, science is great if it actually prove something, but science hasn't proven shit as far as explaining creation, so that just makes these theories exercises of faith in their own right.

Did you know that the 'moon goes around the earth' is also a theory. You are so ignorant on this subject, that you dont even know what "scientific theory" is.

I might not be so blunt about it, but you DID just tell me to go to hell, aka 'burn in the worst place in the world for all eternity'. Quite harsh, dont you think? Lucky for me it dosnt exist.

No point in even argueing w/ people who cant even consider sound arguments b/c of their prior notions, so whats the point. Sephin still wont tell me how old and what state he's from. Texan is obviously from Texas, so I can understand why he dosnt believe in evolution.
 
I should know better than to get into something that is nothing more than a pissing contest. I'm not usually that crass but it seems to be the case. Their is/was a film out that shows a human foot print in a dino print cut a part.
Which shows compaction from both being made at the same time (in mud). the fossil records fit the great flood better than billions of years, at least to me.
Remember mount staint Helen's? made a Minny Grand cannon in 20 mins.
Please explain to me how trees have been fossilized standing up-rite though million or billions of years if you can.
 
one more thought since mosquitoes have been around by your belief for millions of years are they your gods? Since they haven't seen the need to evolve they must be a Superior form of life.
 
Hmmmm, got out of hand there for a bit, huh?

Casey,

I am a scientist. Couple of BS degrees. I know a bunch of scientists from all over the world. For the most part, they are all either Jews, Christians, or Muslims. There are a few agnostics, but not too many.

It seems many folks here believe there are either scientists or creationists, and never the twain shall meet. That is simply wrong. At this point in time, there are so many things that science cannot, or has not explained. There are also things that the Bible does not explain, usually because it does not have to. Not the purpose.

Science and the Bible are not at cross purposes. Science does what it does, trying to answer questions with available evidence. For many years, there were guys trying to disprove the Bible, but they failed. Now it seems most scientists are honestly trying to find answers to questions. Period.

I would recommend reading up on the most recent scientific evidence of the beginnings of man. As I said in that paper, very few facts, according to archeology, of the Bible, are contradicted going back to the creation story. If you examine the recent evidence, it is beginning to look like creation is a possibility, according to science. But even if science conclusively proved creation, many still would not believe. That is OK too. In fact, the Bible predicts the degree of unbelievers.

I guess most guys did not read the passages about evolution theory and where it stands now. There are as many theories, and subtheories about evolution as there are researchers. But one thing I can say for sure after reading the comments above; most of you do not understand where the facts concerning evolution have lead scientists. Gradualism is dead. Natural selection as a method by which evolution occurs is dead. Period. Micro evolution is a fact, but it does not lead to evolutionary change. This is not my opinion. This is the conclusion of the men and women in the field, many of whom I quoted.

The biggest problem that I see comes in the disemination of all of this information. The thoughts and conclusions of most scientists today simply do not get 'out there' in a form where most lay folk can understand it. The work in mtDNA is fascinating. It is also ground breaking stuff. Hopefully, within the next few years, the data can be presented in an easy to understand manner, and all will be enlightened.

In the paper above, I had one real goal. To show that science and creationism can and do coexist. One does not preclude the other. So far, the evidence proves this is true. There has been nothing, that I know of, produced by science, that disproves the writings within the Bible. If you know of something, I will surely look at it.

On another note, it really bothers me when people of faith become antagonistic to people who do not believe. That is counter to the teachings of the Bible. You have to let it go. Many folks just will not believe no matter what. It is not the job of others to castigate or judge them. They must have the free will to decide for themselves.

I have many agnostic friends. I love them just the same as any other friends. I wish the best for them and all of you. Further, I will tell you right now: I am a sinner, and am not a better person than anyone else here. That is a fact I am sure of.

Bigger
 
AncientChina said:
Well if you read longtom's post they found a human footprint within a Dinosaur's footprint. So that means that humans and Dinosaurs were around at the same time, right guys? :s I mean after hearing that "fact" we should all believe that Dinosaurs and humans were around at the same time right, I mean it's a "fact". :D I guess that is a good creationism way to make an excuse wait I mean "explain" Dinosaurs history timeline ROFLMAO. :D

They were cool looking, my favorites were the Raptors, KICK ASS! :D

Yeah, this is another beleif they tried to shove down our throats at camp, when some kid asked "I thought dinosaurs were around before people"......This woman behind me said "No, NO, Scientists found a human foot in a dinosaurs mouth"
Like it ate it for dinner......I laughed in her face, at how absurd this sounded, from a 30 year old to a 12 year old......
 
sephin said:
BUT if you consider the validity and complete perfection of the Bible, I find it perfect proof.

and if anyone wants to claim something as absolutely 100% correct, they will shoot it down without going any further. They wont look into it. They wont hear evidence for it.

They are the epitome of the stubborn hypocrite. ;)

Look real hard at what you just said my boy.....As for AC's defence mechanism of laughing at what you say, 70% of your posts start with a LOL or a yawn - insight



ANd Texan, this is the second time you turned a good debate into an "EMOTION FEST", ohh oooohhh, their trying to Slander Christianity.....No man, we're just having an argument, make some good points instead of getting all hot-headed and telling all us non christians to go to hell.....I know you guys settled this but I just dont want to see it again in a couple pages my Penis Enlargement brother :)

As for me thats it, Im getting the hell outta Dodge
 
Help Users

You haven't joined any rooms.

    You haven't joined any rooms.
    Back
    Top