What are your views? Why are we here How did we come to be? How did the universe start?

Well scientists know the universe has a beginning and an end. Anything with a beginning and an end, came from something else. You can't keep going back (infinite regression), so we know there had to be something infinite, that always was and will be (no beginning, no end) that could create everything finite (has beginning, has end). I believe God is this infinite.

Pretty much the Miller-Urey experiment and the impossibility of inifinite regression of time and the universe, disproves evolution (among many other extra experiments and details - these just the simple easy ones to understand and explain).

You would think the order of the universe and its makeup, is a design. Designs come from designers. Intelligent design is almost undeniable. What say you all?
 
Any and all "logic" induced to prove some sort of intelligent design is bullshit and flawed in some way. Intelligent design is, IMHO, a last-ditch effort by theologians to push the idea of a creator god into people's minds. There is no proof of any such creator and anyone who has the gall to say, "Well, prove god doesn't exist, then!" is just being silly. Believing in something just because you can't prove it doesn't exist is not suitable grounds for founding a belief that shapes your life.

But, I digress. String theory is taking over the cosmology world; it seems to have a plausible explanation for holes in other theories (e.g. the unification of the strong, weak, and EM forces made by numerous theories of the universe which all cannot account for the fourth force, gravity, at all). A certain fundamental vibration of the strings lends itself exactly to the existence of the graviton.

The Big Bang was a physical certainty. It happened. The basic matter particles of the universe (quarks and electrons) were manifested about 1 second after the intial expansion and atoms were formed about 10000 years after the bang. String theory dictates 10 dimensions, including time. Three of these (and time) expanded after the bang, while the remaining 6 remained curled up in a space whose size is along the lines of 10^-34m. These dimensions are wrapped up by the strings which make up the universe and are manifest in shapes known as Calabi-Yau shapes.

Why did the universe begin? Who knows? How did it begin? Well, we are getting closer to understanding that. I recommend Brian Greene's "The Elegant Universe" if you want to read about string theory.
 
Sephin, you go to church dont you...

I would like to think there is a god, afterlife and all that.....but I think science is disproving that QUIK.....But if there is, Humans are no more significant than a parasite, or any of the other trillions of species on other planets for that matter (it would be pretty naive to think the dont exist, since we do dont you think???

Our universe started just like all the rest, Outside our universe is the Multiverse, An infinite stretch of space that holds infinite amounts of universes, so ours again is not significant at all....Not sure how this adds to anything, but.....

String theory looks pretty promising though....You guys sound like pretty intelligible chaps, Im just one of those underschooled peeps that reads lots of Scientific American, but cant explain whats in his head because of a slushy mixture of A.D.D and too much dope.....
Glad to see a thread like this on the forum, just trying to add to it

Peace
 
Last edited:
I'm not doubting the Big Bang occurred. It is a scientific certainty it did.

None of your string theory or what you said discredits God or intelligent design. Just your opinion backed by fact on how the universe is, not how it came to be.

Any and all "logic" induced to prove some sort of intelligent design is bullshit and flawed in some way. Intelligent design is, IMHO, a last-ditch effort by theologians to push the idea of a creator god into people's minds.
Exactly. In your biased opinion. There is plenty of facts that back creationism.

It takes more faith to believe there wasn't/is intelligent design, than it does to believer there was/is.

There is no proof of any such creator and anyone who has the gall to say, "Well, prove god doesn't exist, then!" is just being silly. Believing in something just because you can't prove it doesn't exist is not suitable grounds for founding a belief that shapes your life.
The Bible claims God created the universe. There has yet to be anyone who has disproven something the Bible has said. Hundreds of prophecies in it have come to pass, and more have yet to pass.

The historicity of the Bible is undeniable. When it was written. The fulfillment of prophecies that came later in history are well documented by numerous non-christian historians and sources. The mathematical probability of all these prophecies being predicted and coming true by chance, is in math terms an impossibility. Foreknowledge was key to them all coming true.

1) Israel would be re-united again as one nation Ezekiel and other books of the Bible say this
2) The exact year Israel would be re-united
In Ezekiel 4:3-6, the prophet said the Jews, who had lost control of their homeland, would be punished for 430 years. This prophecy, according to Bible scholar Grant Jeffrey, pinpointed the 1948 rebirth of Israel. Here's a summary of Jeffrey's theory:

1. Ezekiel said the Jews were to be punished for 430 years because they had turned away from God. As part of the punisHydromaxent, the Jews lost control of their homeland to Babylon. Many Jews were taken as captives to Babylon.

2. Babylon was later conquered by Cyrus in 539 BC. Cyrus allowed the Jews to leave Babylon and to return to their homeland. But, only a small number returned. The return had taken place sometime around 536 BC, about 70 years after Judah lost independence to Babylon.

3. Because most of the exiles chose to stay in pagan Babylon rather than return to the Holy Land, the remaining 360 years of their punisHydromaxent was multiplied by 7. The reason is explained in Bible's book of Leviticus. (Leviticus 26:18, 26:21, 26:24 and 26:28). In Leviticus, it says that if the people did not repent while being punished, the punisHydromaxent would be multiplied by 7. And, by staying in pagan Babylon, most exiles were refusing to repent.

4. So, if you take the remaining 360 years of punisHydromaxent and multiply by 7, you get 2,520 years. But, Jeffrey says those years are based on an ancient 360-day lunar calendar. If those years are adjusted to the modern solar calendar, the result is 2,484 years.

5. And, there were exactly 2,484 years from 536 BC to 1948, which is the year that Israel regained independence.
3) Israel's army winning against serious odds
In Leviticus 26:3, 7-8, the Bible says that the army of Israel would have a supernatural power to prevail during times of conflict, if the people are obedient to the Lord. This Bible passage says that 5 people would be able to chase away 100 people, and that 100 would be able to chase away 10,000. Is there any proof to this incredible claim? Judge for yourself:

Example 1: Within hours of Israel's declaration of independence in 1948, Egypt, Syria, Jordan, Iraq, and Lebanon invaded Israel. The combined population of those countries was at least 20 million at that time. Israel had fewer than 1 million Jews. Even so, the Jews won the war and expanded the size of Israel by 50 percent.

Example 2: During the War of 1967, Israel attacked the air force bases of the surrounding countries and took control of Jerusalem for the first time in about 2000 years. They also seized additional territory. That war lasted a mere 6 days.

Example 3: On Oct. 6, 1973, Israel was attacked by Egypt and Syria. Other countries later joined the attack. But the Jews were able to push back the attacking armies and occupy land outside of Israel's borders.

Leviticus 26:3, 7-8
"If you follow my decrees and are careful to obey my commands, … You will pursue your enemies, and they will fall by the sword before you. Five of you will chase a hundred, and a hundred of you will chase ten thousand, and your enemies will fall by the sword before you."
4) The fortunes of Israel would be restored
In Deuteronomy 30:3-5, the Bible said the Jews would be scattered worldwide and that they later would return to their homeland and have their fortunes restored. This prophecy began to be fulfilled in modern times during the late 1800s when many Jews returned to Israel, from as far away as China and the United States, Russia and South Africa. Israel declared independence in 1948. Today, Israel is among the world's most prosperous countries. In 1999, for example, Israel's per capita Gross Domestic Product was twice as prosperous than the neighboring countries.

Deuteronomy 30:3-5
then the Lord your God will restore your fortunes and have compassion on you and gather you again from all the nations where he scattered you. Even if you have been banished to the most distant land under the heavens, from there the Lord your God will gather you and bring you back. He will bring you to the land that belonged to your fathers, and you will take possession of it. He will make you more prosperous and numerous than your fathers.
5) Egypt would never again rule other over other nations
In Ezekiel 29:15, the prophet says that Egypt would recover from a desolation (perhaps Babylon's attack about 2600 years ago), but that it would never again rule over other nations. Up until the time of Ezekiel, Egypt had been a world power for centuries, dominating many nations, including Israel. But for most of the past 2500 years, Egypt has been controlled by foreign powers, including the Romans, Ottomans and Europeans. Today, Egypt is an independent nation again. In 1948, 1967 and 1973, Egypt tried to dominate Israel but was unsuccessful each time, despite the fact that Egypt is 10 times larger than Israel. Egypt today, in many respects, is an impressive nation. But since the time of Ezekiel, it no longer rules over other nations.

Ezekiel 29:15
… I will make it so weak that it will never again rule over the nations.

There are more, but those are just 5 I snagged from one website 100prohpecies.org.

Other prophecies such as the mark of the beast are in the works and soon to come.
In Revelation 13:16-18, the Bible says that there would come a time when a powerful leader would force people to receive a "mark" on or in their right hand or forehead, and that no one would be able to buy or sell unless they had that mark. When the book of Revelation was written about 1900 years ago, it would have been nearly impossible for a world leader to force everyone to receive such a mark. But, today, with modern technology, it would be much easier. Today, for example, it would be possible to implant under a person's skin a small microchip that could be used like a credit card.

Revelation 13:16-18
And he causeth all, both small and great, rich and poor, free and bond, to receive a mark in their right hand, or in their foreheads: And that no man might buy or sell, save he that had the mark, or the name of the beast, or the number of his name. Here is wisdom. Let him that hath understanding count the number of the beast: for it is the number of a man; and his number is Six hundred threescore and six.

My uncle is working on a small chip that can be implanted subcutaneously, as a way of identification. He is unsaved, but I told him about it, and he nervously smiled.

Anyhow. Search the internet on your own. There are seriously hundreds of websites with over 300 prophecies from the Bible that have been fulfilled, and lots more to be fulfilled. Im too lazy to post em, but they are easy to find.
 
VladtheImpaler said:
I would like to think there is a god, afterlife and all that.....but I think science is disproving that QUIK.....But if there is, Humans are no more significant than a parasite, or any of the other trillions of species on other planets for that matter (it would be pretty naive to think the dont exist, since we do dont you think???
Bullshit... There's you a scientific fact. Science can't disprove God. How many times have you monkey-descendent-wanna-be's told me that "science can't disprove God because you can't prove a negative."

As I've said before, as a Christian, if I'm wrong I'll never know the difference, but if I'm right, you monkey-worshippers are screwed. Forever.

I think it's funny how monkey-men try so hard to prove that Christianity is wrong... it's like some deep seeded conviction compels you to justify the void in your soul.

I know this post doesn't sound overly Christian, but I get sick and tired of people trying to make Christian look dumb. You can't prove your beliefs with anymore certainty then we, so open your mind and admit it's possible or bug off.
 
Great Jihad Texman, that was a pretty harsh little ditty.....Ungrounded for sure, Im not gonna fuck around with quotes or nothing, but HOLY SHIT, not a word makes sense.....

Look at the first sentence you quoted (scribbled on treebark from yours truly the monkeyman wannabee) which totally discredits all that you have said freind.....

Now AGAIN I SHALL SAYETH: If god and an afterlife are real, then that is a great thing.....But if he is real and such a divine and merciful creature, then I dont think he would throw all us good moral people(that dont pray) into the fiery pits of hell, just because we dont go to church, and give money to it.......

I agree with the moral standards of your religion, but not that "if you dont give your life to god your divinely fucked", thats bullshit and if its true I want nothing to do with that lord.......
Hope this clears things up Tex, I like your posts and you seem to be a funny, happy-go-lucky guy......
But I think tthis time I should be crying BULLSHIT on you and not the other way around!!!

Thankyou
 
String Theory.

Watch the special.
Once again. Proves how the universe is made up, not how it was made.

I think it's funny how monkey-men try so hard to prove that Christianity is wrong... it's like some deep seeded conviction compels you to justify the void in your soul.

I find it funny. In science you go into the matter unbias and see where the facts point. Evolutionists went in trying to prove a be all end all theory of the universe based off of some birds and how they adapted.

The theory was filled in with science, and holes are still left, and it is taught in schools. Hilarious how bunk the theory is and how it is taught in school.

I still challenge you all to visit those sites. Until you do, I don't see how you can see my side of the story *ahem* ancient china... Pop in and say what has already been said and redirected back to, then pop out.

I would like to think there is a god, afterlife and all that.....but I think science is disproving that QUIK.....But if there is, Humans are no more significant than a parasite, or any of the other trillions of species on other planets for that matter (it would be pretty naive to think the dont exist, since we do dont you think???
LOL. The more we learn of science the more the Bible is seen to corrolate in perfect harmony with it. There were things in the Bible people refused to believe until science would prove it. Things that came thousands of years before scientists would say it was true, because they had to run experiments.

Humans are more important than any other thing on earth because we are the most intelligent. We have created so much more than any other critter. Our thinking level, social orders, etc are so much greater than any other thing.

The special? http://www.pbs.org/wgbh/nova/elegant/ that?

ANYWAYS, string theory is even in the bible http://www.2ndcheek.com/stringtheory1.htm

Acts 8:38-40
Genesis 5:24
Hebrews 11:5
2Kings 2: 11,12
Acts 8:26
2 Kings 2:1-15
Rev. 21:1
etc etc etc

I love new discoveries in science. They seem to either prove or perfectly coincide with my faith.
 
then I dont think he would throw all us good moral people(that dont pray) into the fiery pits of hell, just because we dont go to church, and give money to it.......
Hahaha. We are born into sin. We are imperfect and it is our nature. We do not DESERVE to be with God, which is the epitome of heaven, prescence with God.

BTW, you aren't saved by going to church or giving money, only by confessing Him as Lord and asking him to be your God, and repenting of your sins.

Anyways, I find it funny how people say, evil exists in the world, and good and moral people can burn in hell according to the Bible. I ask them their point. Evil exists due to free will. We ALL sin. Every single person in the world. This sin separates us from God and if we don't repent we go to hell. Salvation is a gift. A mercy we do not deserve. If God withholds it, it isn't our place to say we were good people so we deserve to be let into heaven.

It's like everyone kicked bobby in the shin, and no one is invited to his party, unless they say sorry. Everyone wants to be there "own man", "independent", and all that BS, and like the parable (aeop's fable, not the Bible ;)) of the fox and the grapes, you swear it will suck or doesn't exist.

And you say your a generally good person, so if bobby doesn't invite you, then he is just being a jerk and you want nothing to do with him.

It doesnt matter how good a person you are to everyone, your sinful nature offends God, and if you don't repent your not invited into his party in heaven.
 
I cant even believe your trying to say that evolution is somehow not legit. That stuff about intelligent design is just a scientific euphemism to try and slip religious crap over people's eyes.

All that stuff about prophecies is crap too. I can find sites that say 2pac is coming back b/c off all the prophecies he wrote about in his songs. The bible is wrong. The bible says the earth is 6000 years old which isnt true. It also says that if you work on the sabbath (sunday) you should be put to death.

So the bible says a lot of crazy stuff, noah and the flood, jonah in the whale, etc. So the bible is just there for moral guidance and are not meant to be taken literally. Its hilarious that your trying to say that science is on the side of the bible or religion.

God is different than religion. I may believe in god, but I will never believe in religion. How can any rational normal person do so? They say a "a religious fundamentalist" is someone who demands and only will accept a LITERAL interpretation of the bible.

Just like our islam extremists enemies.
 
VladtheImpaler said:
Great Jihad Texman, that was a pretty harsh little ditty.....Ungrounded for sure, Im not gonna fuck around with quotes or nothing, but HOLY SHIT, not a word makes sense.....

Look at the first sentence you quoted (scribbled on treebark from yours truly the monkeyman wannabee) which totally discredits all that you have said freind.....

Now AGAIN I SHALL SAYETH: If god and an afterlife are real, then that is a great thing.....But if he is real and such a divine and merciful creature, then I dont think he would throw all us good moral people(that dont pray) into the fiery pits of hell, just because we dont go to church, and give money to it.......

I agree with the moral standards of your religion, but not that "if you dont give your life to god your divinely fucked", thats bullshit and if its true I want nothing to do with that lord.......
Hope this clears things up Tex, I like your posts and you seem to be a funny, happy-go-lucky guy......
But I think tthis time I should be crying BULLSHIT on you and not the other way around!!!

Thankyou
Yeah, sorry Vlad; that was a little harsh. This is a subject that has been beaten pretty hard at this place, granted I believe most or all of it was before you joined (I don't know if you lurked for awhile or not). For what it's worth, I am a Christian, but I don't subscribe to a "religion." Religion is man made amd it's what generally gives Christianity or any belief a bad name. Religions have been the basis for many bad deeds throughout history and if people confuse man made religion with true Christianity I can see where negative opinions form.

Anyway, thanks for not coming down too hard on me...
 
As much as I don't want to get involved in this discussion (because I can get really heated about this topic :D), I will say that science cannot disprove divine creation, and if God created the universe (which I believe He did), that does not disprove science. In any way.

Some food for thought: Stephen Hawking attends church every Sunday.

There. You now have no reason to think that science disproves God. The man who came up with many of the theories that you use to try to discredit creation attends church and believes in God. This says to me that you have no idea what you're talking about and you're just using bad logic and bad arguments so you can convince yourself that you don't have to live by any moral code or believe in God.

Oh, and I agree with this quote by Texan:

For what it's worth, I am a Christian, but I don't subscribe to a "religion." Religion is man made amd it's what generally gives Christianity or any belief a bad name. Religions have been the basis for many bad deeds throughout history and if people confuse man made religion with true Christianity I can see where negative opinions form.

Very well said!
 
Last edited:
Casey you are funny.
I cant even believe your trying to say that evolution is somehow not legit. That stuff about intelligent design is just a scientific euphemism to try and slip religious crap over people's eyes.
Micro evolution is proven and I believe it. Cross-species evolution and macro-evolution (we all came from primordial soup yada yada) I do not believe and has not been proven.

All that stuff about prophecies is crap too. I can find sites that say 2pac is coming back b/c off all the prophecies he wrote about in his songs. The bible is wrong. The bible says the earth is 6000 years old which isnt true. It also says that if you work on the sabbath (sunday) you should be put to death.
Complete joke to even compare the two. I don't know about the 2pac prophecies, but all those are just expounded on farshots as many prophecies are. They are somehow related and normally the relation is found (and forced) after the truth happens.

The Bible gives DIRECT and SPenis EnlargementCIFIC prophecies and the years those prophecies were written are ACCURATE and CORRECT. Don't even try to compare 2pac prophecies with a book proven to be written over 2000 years ago. The Bible does not say the earth is 6000 years old you idiot. Read any of the bloodlines listed in the Bible and it goes back way more than 6000 years.

I would rather read a book literally as its literal translation has never been proven false, than ignorantly quote completely wrong, out of context, or missing other pertinant parts to the verse, from the book.

Show me the verse where it says if you work on the sabbath you shall be put to death. If you can show me one I am sure it is in the old testament under the OLD covenant which we are not under, due to Chris dying on the cross. We are in the new covenant.

The verse you are thinking of is in exodus and deuteronomy, which say you will not work on the sabbath, but if your mule is stuck in a ditch to pull him out. It never even speaks of death. See the third commandment.

You are obviously ignorant of the Bible and your silly statement "The bible is wrong," is simply comical. Show some proof. Cite some sources. Maybe your convictions won't be so laughable then.

So the bible says a lot of crazy stuff, noah and the flood, jonah in the whale, etc. So the bible is just there for moral guidance and are not meant to be taken literally. Its hilarious that your trying to say that science is on the side of the bible or religion.
The ark was easily doable. Do a search on it and you will find plenty of sources citing the specs of the ark and how it was more possible than the pyramids.

The flood is seen through the fossil record and other geological evidences. Jonah in the whale is also very possible.

God is different than religion. I may believe in god, but I will never believe in religion. How can any rational normal person do so? They say a "a religious fundamentalist" is someone who demands and only will accept a LITERAL interpretation of the bible.
I agree about religion and God. Religion is just tradition and ceremony built up over time.

Almost every single Christian organization, and every single church I have been to including the 2nd biggest one in all of California (who has their own crusade, website, TVshow, radio, etc), all believe in a direct LITERAL translation of the Bible.

As it stands, it has never been proven wrong in over 2000 year, in its literal translation. But honestly don't look ignorant and silly, especially the facts considering something you know little of, especially when it is the opposition. Just stop.
 
I see that a nice, heated debate has already sparked up! Good!
I won't bother to retype all the things I've said in previous similar topics on this forum, but to make it short, I agree the most with VladtheImpaler. IF god and an afterlife exist (I certainly hope so... even though the prospect of nonexistance isn't really all that frightening once you really think about it), then all the more power to you Christian fellows on the boards. However, I find most organized religions downright despicable, chastising and insulting in the way that they expect extreme gullibility and sometimes even blind faith from the populace. I have studied the bible somewhat (not too deeply, though), and I find a lot of contradictions there. The pieces just don't add up in my mind. I simpy cannot come to terms with the claim that we humans are somehow superior and totally unique in the universe... and I ESPenis EnlargementCIALLY have a hard time swallowing ludicrous claims such as the creationist theory, which has literally nothing behind it to back it up: only the assumption that people should just ''buy into it''.
As has been stated in the topic, I do agree, and abide by, most of the so-called Christian moral rules. However, I have NEVER needed Christianity to teach me to love and respect life in all it's multitude- both human and animal- that is something I have been born with. In fact, I never felt comfortable when attending church even as a child; it all felt like empty, hollow rhethoric to me. That has not stopped me from ''walking the right path'', though. To sum it up, I guess I just don't feel like I NEED Christianity (or any other organized religion) to guide me through my life. The promise of an afterlife sounds tempting, but even though I'm not a devout Christian (I'm still registered as a protestant, being born into it), I'm sure my spirit won't rot in hell once I'm gone, if it turns out that there really is life after death.

I suppose you could say that I am a careful optimist when it comes to matters regarding the (possible) afterlife. It's just too big a thing for the human mind to be able to process or comprehend, so I'll just leave it at that and wait n' see what happens.

On a side note, I do believe that we are just one among multitudes of intelligent civilizations in our universe. It would be the coolest thing I can think of if we somehow got in contact with one of them... or better yet, got our hands on compelling evidence that they've already been here. There's certainly plenty of circumstantial evidence (and even some hard proof) that seems to indicate this... ;)
 
The ark was no easily doable, it was impossible. Do you know how many different creatures and species are on this earth, all around the globe, extending to far reaching continents such as Australia. The bible depicts the normal animals such as cows and horses, but what off the other half a million species that were unknown to man even then. The Ark was not and is not more possible than the pyramids.
All opinion as you support no facts. No animal housing numbers, manpower studies, or anything relating to the ark. All opinion. Cite a source or something, your opinion is simply that, opinion.
Check out http://www.rae.org/noahfaq.html http://www.rae.org/pagesix.htm and http://www.rae.org/bits22.htm for Noah Ark facts.

One fact I find very interesting...
Today there probably are about a million species of animals. But many of these have developed in the years since the Flood. "Species" is a modern term, different from the term "kind," as used in the Bible. The "dog kind," for example, includes all the modern dogs, wolves, coyotes, some foxes, and others. So there weren't nearly as many kinds of animals for Noah to load. The majority of today's species are aquatic -- the ark only carried "air-breathing" kinds, and many of these are small. Most likely its load was equivalent to about 50,000 sheep-sized animals. This would leave lots of room for Noah's family and all the food required.

Sometimes I wonder if people are debating from an unbiased stand point or if they have something at stake here, their religion and will debate even on the weakest points to protect that image. I am not down with the Christian bashing and I felt many of the threads a few back were pointless and rude to everyone. I can assume as much as it is annoying for Christians to hear all of this the vice versa is true for non-christians. I don't believe in the the Christian's view of "God", I am unsure if I believe in a higher power, most likely I do, but to me it is not the God written about in Christian, Muslim and other text. Christianity is realitively new and furthermore the Greeks believed in their Gods just as passionately has Christians believe in their God today, doubt it makes any which one of them "right".
Debating from an unbiased stand point? Haha. Debating is 2 sides trying to proove their side right. Debate rarely comes up unless someone feels strongly about something. Whether I am bias or have something at stake is no relevance to the debate and the facts.

I find that people will stake claims that are simple 1 line opinion statements in a debate, to protect their comfort with what they believe to be true and false. Please list some facts if you want to prove or disprove something, like I have.

I think the Judeo-Christian God is the right one because the flawless text that has been around for 2500 years and has been proven over and over again.

Gtg answer the rest later.
 
The Ark doable, yeah I think not......1 000 000 species, again no way.....we have still not discovered like 60% of the animal kingdom (given most are insects, but still)

How do you feed these animals for 60 days(Carnivores too)?
How do you make sure they dont mangle each other?
How do you build a boat that has to be like 100 times the size of an oceanliner???
How do you round up all the animals??
Where does all this wood come from?
Who builds the boat??? Noah??

Sephin you seem to blindly cling to this idea.....do you beleive every single word in the bible???
I myself feel silly for just replying to this.....
The world is this big for a reason

PS i checked that those Ark links out (because I do like to see others side of it) and I hope others do too, becuase, damn, that is really unintelligent bullshit....dont answer any REAL questions
 
Last edited:
This is my Experience of Christianity

As a youngin' I went to a United church that had a kickass preacher who IMO just thought of it as his personal stage show because all he did was make jokes and stuff like that, he was good at teaching about GOD because it was layed back and you didnt fall asleep cuz it was boring or nothing, and you didnt want to miss a joke....

Second Christian Experience:

Well I went to a summer camp that was a pretty fun, except for in the night, when these ultra elite Christian Extremists would try to get you to give your life (12 yr/old) to GOD and their religion.......ie: BRAINWASHING

Some things I thought were outright disgusting about it:

First of all, they would tell stories about when they were missionaries and go to other countries where the religions were outright evil (ie, anything not christianity) and how it scared them so much, but they prevailed to show many the light of christianity, I call this destroying other cultures and beleifs.....ANd by the way this came from the tightest little asian I have seen to this day, love to bang her.....Still didnt fall for her bullshit though......

ANother thing I remember them pressing was the need, if it came to it to "DIE FOR YOUR RELIGION".....You better beleive that your eastern enemies arent the only ones to think this way......

They told about some school (i dont think Columbine) where psycho's went around putting guns to peoples heads yelling "Do you beleive in Jesus", the ones that did got shot, the others didnt......
These people at the camp told us to be the ones to die for jesus, because if we didnt we would burn in hell (obviously different wording, but thats pretty much it)....

I didnt much think about it at the time because I was bored and wanted the next day to come, but when I thought about it, that is really fucking sick,
So one religion is no worse than the next......
(I may be going out on a limb here, but)
I bet if The East was the Superpower and The states was the little country that was getting fucked with, I bet the current events wouldnt turn out too different.....and the christians would use the same methods......

THats my question to you Christians (who Ionly have love for, I would just really like to know) Would you die for Jesus, in the way that the Islamists do, if it came to it????

Obviously, any moral person would die for a BELIEF, I would take a bullet for someone that mattered any day, but the way that these people said it at camp was absolute insanity....
 
Today there probably are about a million species of animals. But many of these have developed in the years since the Flood.

This thread has become derailed, but...whatever...

Regarding that quote above, which is obviously biased from a Christian point of view, do the Christians among us believe that statement? That evolution has indeed taken place since the speculated time of the speculated flood?

Oh, and that link that ties in bible verses with string theory made me laugh so hard. I haven't seen anything so desperate in all my life. If you honestly believe that the people who wrote the bible--hey, back when the world was flat and had a sun that revolved around it, remember?--had any grasp on more than three dimensions or any sort or parallel dimensions of quantum fluctations, you really need to check yourself into an asylum.
 
AC - More good points, I definitely think those other cultures are better off whithout it, they sure dont seem to be more fucked than ours anyway.....

Redshift - Yeah I thought we were gonna be talking about parellel dimensions and other universes and stuff, I get giddy as a little girl thinking about stuff like that.....maybe you should start a new thread called "Strictly Science" lol, so it cant possibly turn into a holy war......

Though, I am still getting my kicks outta this one
 
Introduction
About the time I started seriously studying the bible and contemplating baptism in the early seventies, I read a news story about some researchers who were attempting to create life from simple chemicals. The story was that these scientists had produced something similar to amino acids in the lab and with the proper environmental conditions they would be able to generate a life form. I had attended the Church of Christ three times a week for my entire life. I also had received an indoctrination in evolution in school and I was trying to mesh what I heard in church with what I was taught in school. As you can imagine, it was a very trying and confusing time. This news story and others like it actually helped me to make the decision to become a Christian. This is because I realized exactly how ignorant man is and how limited our understanding of God’s power is.
I went on to take many more courses in science in high school and college. I learned how to utilize scientific method: develop a theory, test the theory using verifiable means, document the results, and adjust the theory to fit the facts. I also grew spiritually. Each time I read or heard of some new scientific find or archaeological discovery, I could usually see how it would fit in God’s history or His plan. My faith in God and Jesus has continued to grow. Now 25 years later I wonder if those guys are still trying to produce life in a laboratory.
I suppose that I and others of my generation were fortunate. Today’s kids are so bombarded by "scientific facts" that seem to contradict the Bible that it is sometimes amazing that we have any new Christians. In the 1995 Grollier’s CD-ROM encyclopedia, the biblical creation account is referred to as a myth. College has ruined many a good plow hand. This is the reason I decided to investigate today’s scientific viewpoint and compare it to God’s account of creation. The Bible devotes only a few pages to our creation while science has accumulated mountains of information much of which is designed to contradict the Bible. Children need to hear about our true origin. They need to be given the opportunity to develop their own faith. What they need are the facts as we know them now. They will see that the Genesis account of Creation is more believable than evolution.
Job 38-40. God should not have to explain his creation to us. He certainly didn’t feel he needed to explain things to Job. This lesson is meant to ask the questions that are on the minds of children and to give answers or possibilities or theories to those questions. This lesson will also show that the Word cannot be compromised by any scientific theories. The majority of people who question creation have probably never read the biblical account to know with what they are arguing. The Christian should know not only what the Bible says, but also what the bible does not say. We do not know how God created our universe. As can be seen from Job, He did not mean for us to know.

Creation Vs Science. Testing the words of God by what science claims.

1st Day……Light, the 1st morning
In the biblical account of Creation, what happened on the first day (Gen 1:3-5). And God said, "let there be light". According to physics, light is what? Electromagnetic radiation produced from a chemical or physical (electrical) or nuclear (fusion or fission) reaction. God made man in his on image. When man begins a project indoors or at night, what is the first thing he does? Does this light have to be the sun or stars? Was there any fusion reactions occurring at this time according to the Bible?

Before the 1st Day…….The heavens and Earth water
So the first day there was light. But what was there before the light? Gen 1:1. "In the beginning , God created the heavens and the earth." When was the beginning? Obviously The Father, The Son, and The Holy Ghost were here when the heavens and earth were created. What were they doing before they created the heavens and the earth? The Bible must be referring to the beginning of our world. But it does not mean that the heavens and the earth were created on the first day. What was spoken into existence along with light? Obviously it was the first morning. With the first morning and then evening and then the next morning ended the first day. "And God said….evening and there was morning, the first day. These phrases were not used in Gen 1:1-2.

And God said "Let there be light". First Morning
Evening
Morning the first day.
Evening
Morning the second day. Etc.
So at some point in time before the first day the heavens and earth were created. At the time of the first day we had:
1. The heavens.
2. The earth. Formless and empty. Or became formless and empty?
3. The deep.
4. Water.
When were these created?
Science tells us that the universe is up to 10.7 billion yrs old. Also it says that our solar system is 4.65 billion yrs old. Does the Bible disagree? The Hebrew word for created (bara: something from nothing) is used only three times. 1, in the beginning, the heavens and the earth. 2, the animals on the fifth day , and 3, man on the sixth day. All other divine creations use the word asah which means to form or fashion or finish.
At some point in time, the earth became formless and empty. What does this mean? At some point in time did the earth have form and was full? Science says that the fossil record (and supposedly life) starts 3.5 billion years ago. These fossils were of bacteria. The dinosaurs supposedly lived 100 million years ago. Mammals came along 65 million years ago and the earliest humanoids are a few million years old. Where did all of this fossil record come from? Is there precedent for destruction from God? Does God promise ultimate destruction by fire? Could He have created other life forms similar to those found today before Genesis 1:3? Science has determined that over time the earth has gone through many periods of great destruction. These events were caused by ice, asteroids or comets, and flooding. Jer. 4:23-26, Isa 24:1, and Isa 45:18 indicate that the earth had undergone a cataclysmic change as the result of a divine judgment. Also Ezk. 28:12-15 and Isa. 14:9-14.

2nd Day……….the sky
On the second day, God created the sky (Gen. 1:6-8). "So God made the expanse and separated the water under the expanse from the water above it." This could be the greatest example of God’s power and the absolute truth of the Bible. Science tells us now that of the known planets and other celestial bodies in our solar system, the earth is unique in it’s atmosphere. There are many layers to this atmosphere and its delicate composition is what allows life to occur. It is the only known celestial body with water and a habitable atmosphere. The Bible was written thousands of years ago. It is doubtful the human author knew anything of this on his own. He would have seen water in the seas, lakes, and rivers, but it is doubtful that he knew of evaporation, convection currents, the ozone layer etc. If the Bible is not the Word of our Creator and divinely inspired, why would a mere mortal even think of writing concerning the sky? How would he have known the importance of it? In a later time scientists thought the world was flat! On the earth described in Genesis, with no sun to begin the reaction, there would be no sky. The Bible says that the Lord produced an expanse. He did not create the sky as such.

3rd Day……..separated the water and land, vegetation
On the third day, God Gathered the water to one place and caused the land to produce vegetation. The laws of thermodynamics say that in the absence of an external energy source, matter will tend to rest. In the absence of internal radioactive heat produced in the earth’s core, and in the absence of the sun, the earth would be covered with a film of water or ice hundreds of feet thick. This is exactly the environment described in Genesis. For His plan, he had to produce dry land. You might expect the primitive author to write that the Lord made the dry land. But the Bible does not say He produced dry land. It correctly says he gathered the water to one place. Today water is gathered to one place by gravity and in the polar ice caps. He could have done that by turning on the earth’s internal combustion and beginning the earth’s rotation.

He also produced vegetation. The phrase "according to their kinds or according to their various kinds is used three times. He does not create the plants at this time but rather calls on the earth to bring forth the plants. Were the seed already present or did He simply produce new kinds? Could this vegetation now survive in the environment described? What changes has science recorded at the beginning of the Recent Epoch and when did it begin?

The Recent, or Holocene, Epoch is the younger major subdivision of the Quaternary Period. After the last Pleistocene Epoch glaciation, an interglacial interval of warming followed, causing the glaciers to withdraw (see GLACIER AND GLACIATION; ICE AGES). This marked the beginning of the Recent Epoch. The rate of decay shown by radiocarbon (carbon 14) occurring in early Recent wood, peat, shells, and bones indicates that the Recent Epoch began approximately 10,000 years ago.

Striking changes in the flora took place as successive types of vegetation established themselves in the wake of the melting ice or in response to climatic change. Such vegetative changes influenced human and animal migration as well.

At this point you have water, dry ground, and light. Gen 2:5 there was no rain yet but there were springs to water the plants. Why does the author point this out? In the Bible, man is shown to work with plants in Gen 2:15, 3:17-19,23. When does science say that plants were first domesticated? Where was this? Grolier’s 1.

In MESOPOTAMIA, the region between the Tigris and Euphrates rivers in present-day Iraq (see FERTILE CRESCENT), cultivation began in the 9th millennium BC. The wheel was invented, pulleys were used to draw water from artificial canals, and complex IRRIGATION systems were constructed. Mesopotamians raised wheat and other cereal grains; were skilled in gardening; and domesticated the camel, donkey, and horse.


4th Day…….sun, moon, stars
On the fourth day, God produced lights in the expanse of the sky. The Bible does not say that He created the sun, moon, and stars on the fourth day. It simply states that He produced the lights. The heavens along with the sun, the moon and the stars were created in the beginning (Gen 1:1). All of these lights are caused by fusion reactions either directly or by reflection (moon). How did these fusion reactions begin? For man to produce a fusion reaction, it takes a tremendous amount of energy in the form of heat to get it started. Man has not been able to join atoms and produce this heat in a cold fusion reaction. Some tremendous force had to have begun the processes. Can these processes be turned off? Can humans turn off lights? If they were turned off in our universe, what would happen? Could the lights have been present but covered by dust etc.?

5th Day……fish and birds
On the fifth day, God created the creatures of the sea and the birds. This creation was something from nothing meaning it was a new creation. What does according to its kind mean? This phrase is used twice referring to creatures of the sea and birds. Could it be that these creatures and birds or similar creatures and birds had already existed at an earlier time but in a different form?

6th Day…….animals and man
On the sixth day, God said, "Let the land produce living creatures according to their kinds: livestock, creatures that move along the ground, and wild animals, each according to its kind." The phrase "according to their kinds is used five times. During this time does science record any changes on the earth? Is there evidence of mass extinctions just before Adam? What changed? What happened to the mammoths, mastodons, saber toothed tigers, camalids etc. 10000 years ago?

Change in many mammal species also occurred during the Recent Epoch. The large and diverse mammal fauna of the southwestern United States during the Pleistocene Epoch consisted of numerous large animals--MAMMOTHS, MASTODONS, SABER-TOOTHED CATS, ground SLOTHS, camels, dire wolves, horses, and lions, among others--all of which disappeared in Recent times. Some European extinctions, such as the woolly mammoth, woolly rhinoceros, cave bear, and giant elk, may have been induced by humans, but this possibility has not been proved.

Was anything alive on earth when the Lord was hovering over the water ? No! Can science say without doubt that anything was alive on earth after the last ice age? Altogether, "According to their kinds" is used ten times. When does science say animals were domesticated?

During the PALEOLITHIC Penis EnlargementRIOD--from at least 2.5 million years ago to about 8000 BC--people hunted, fished, or gathered their food (see PREHISTORIC HUMANS). From about 11,000 to 8000 BC flint-edged wooden sickles were used to gather wild grains, which were stored in caves; about 9000 BC sheep were domesticated in the Near East. From approximately 8300 to 6500 BC, during the MESOLITHIC Penis EnlargementRIOD, groups of people began to practice natural plant husbandry by simply broadcasting seeds and waiting for the harvest. The only crude tool needed was a haft of bone, wood, or antler fitted with a microlith--a small, sharp blade of stone--for reaping grain. Dogs were the first animals to be tamed, usually to help in hunting. In the Near East such herd animals as goats, sheep, and cattle were domesticated.

Also on the sixth day God created man. "Be fruitful and multiply and replenish the earth." This is where science (archaeology and paleontology) appear to differ with the Bible. But does it? The first thing that must be done in comparing the two is to create a timeline. The Bible while it is an excellent historical record does not give dates for what occurred in Genesis. As a matter of fact, much of Genesis occurred in what is known as prehistory or prehistoric times. Science tells us that writing came into existence five thousand years ago or 3000 B.C. Everything in Genesis up to Abraham and possibly to Moses time was passed on by word of mouth or by divine revelation. Students of the Bible recognize the word "son" as meaning descendant, "father" as meaning ancestor, "brother" as meaning relative, and begat as meaning ancestor of. If taken literally there are several examples of generations being skipped or years lost. It was obviously not the exact number of years which was important to the Lord and therefore the authors of the Bible.
Missing generations
There were at least several generations intentionally left out of Jesus’ lineage in Matthew 1:1-17. Notable omissions are the three kings, Ahaziah, Jehoash (Joash), and Amaziah. Uzziah (Azariah)was not the son but rather the great-great-grandson of Joram (Jehoram). Matthew most probably had access to the lineage of Jesus, but was it necessary then or now to mention every single generation?
Determination of the timing of the genealogies in chapters 5 and 11 can not be exact because of the meaning of the term begat (ancestor of). For example in Gen. 12:4 Abraham was 75 years old when he departed from Haran, and according to verse 32 Terah died when he was 205, which means that Abraham was born when his father was 130. So if Gen 11:26 says Terah lived 70 years, and begat Abram, Nahor and Haran, it cannot be that Abraham was born when Terah was 70 (Acts 7:4). It must refer to one of the other sons. Abraham was listed first out of dignity. In the same way Shem was listed first even though he was not the eldest.
In Gen 46:18 Zilpah is credited with bearing her great grandchildren. In Gen 46:25 Bilhah bore her grandchildren and in Gen 10:15-18 Canaan bore whole nations.
Most students of the Hebrew text believe the "fathers" in these genealogies are noted men of their times and were the patriarchs of large families. They reigned over more than one generation. If A is the ancestor and B is the descendant, then the age of A is his age at the birth of that child from whom B eventually descended.
At any rate the time of Adam probably is not before 10,000 B.C. and is probably before 6,000 BC which is the date many scientist attribute to the time of Adam when examining the Bible for historical content. It is useful to go forward in time and work back to Adam.
Archeology and the Bible
Archeology back to the time of Abraham 2000-3000 BC has been found to agree with the Bible in every instance. The only sites of Biblical importance that have not been found are Sodom and Gomorrah which were destroyed by God. They may be at the bottom of the Dead Sea. Archeologist for years thought that King David was a fictional character until a monument honoring him was found near Jerusalem in 1992.
Humanity spreads out and bricks are made.
Gen. 11:7. God causes man to change his language at Babel. "So the Lord scattered them from there over all the earth". Science says that prehistoric humans were spread to all the world during the Recent Epoch about 10,000 years ago. 8th millennium BC.
The spread of PREHISTORIC HUMANS to all habitable parts of the globe took place mostly during Recent times.
Gen 11:5 They used brick to make the tower. Science says that bricks were first used in Palestine in the 8th to the 9th millennium BC. They appeared in Mesopotamia in the mid 6th millennium BC.

In Palestine, mud bricks (sun-dried) are first found in levels designated pre-pottery Neolithic A (8th-9th millennium BC) (Kenyon 1979: 26).
Sun-dried bricks first appear in Mesopotamia at Samarran sites Sawwan and Choga Mami (mid-6th millennium BC) (D. and J. Oates 1976: 104). Kiln-fired bricks are first noted during the late Uruk period and become more common in the Jatndet Nasr period toward the end of the fourth millennium (Finegan 1979: 8; Singer 1954: 462; cf Salonen
1972: 72ff).

Prehistoric cities
In Gen 10:8 the first cities which were built or rebuilt after the flood by Nimrod, a descendant of Ham, have been found and dug up to their prehistoric pasts (5th to 8th millennium BC).
Nimrud, on the east bank of the Tigris 31 km (19 mi) south of Mosul, Iraq, was the ancient Assyrian capital city of Kalhu, or Calah, in the Old Testament. Its name derives from the legendary Assyrian hunting hero Nimrod. The city was founded (c.1250 BC) by Shalmaneser I of Assyria on ruins that may predate the 3rd millennium BC.
Nineveh, the capital of ancient ASSYRIA, lies on the left bank of the Tigris River opposite present-day Mosul, Iraq. Prehistoric occupation of the site dates back to at least the 6th millennium BC.
Akkad was an early name for northern BABYLONIA, derived from the capital city of SARGON of Akkad (fl. c.2350 BC). For almost a century and a half Sargon and his successors dominated all of MESOPOTAMIA and at times held tributary lands situated to the east and west.
Sargon and his Akkadians were Semites. Their language (Old Akkadian) is the earliest written Semitic dialect known, and their religious and social institutions clearly set them apart from the people of Sumer to the south.
The ruins of Babylon (from Bab-ili, meaning "Gate of God"), the 2d-1st millennium BC capital of southern Mesopotamia (BABYLONIA), stand beside the Euphrates about 90 km (55 mi) south of modern Baghdad, Iraq. Occupied in prehistoric times but first mentioned in the late 3d millennium BC, the city became important when its AMORITE king HAMMURABI (r. 1792-50 BC) gained control of all southern Mesopotamia.
The ancient Sumerian city of Uruk (biblical Erech; modern Warka) lies 250 km (156 mi) southeast of Baghdad, Iraq. First settled (c.5000 BC) by the prehistoric inhabitants of Mesopotamia, the city developed (late 4th millennium BC) around the two sacred centers of Kullab and Eanna, which have yielded such evidence of early Sumerian civilization as monumental temples (at Eanna) decorated with cone mosaics, sophisticated sculpture, glyptic art, and some examples of the first pictographic writing.
The ruins of Ur (modern Muqayyar), the ancient Sumerian capital and religious center that the Bible identifies as the early home of Abraham, lie about 300 km (187 mi) southeast of Baghdad, Iraq, and about 15 km (9.4 mi) southwest of the Euphrates River, which once flowed past the city. Modern studies have produced evidence that prehistoric occupation of the site (5th millennium BC) was interrupted by a flood that was formerly believed to have been the one described in Genesis.
Ancient Megiddo, identified at the mound of Tell el-Muteselim on the Plain of Esdraelon in present-day Israel, was a major Canaanite city of northern Palestine. Mentioned in the annals of TutHydromaxosis III, it was the site of a great battle between the Egyptians and a Syrian confederation in 1486 BC.
Occupation levels date back to the 8th millennium BC.
Excavations at ancient Jericho, identified as Tell al-Sultan, 10 km (6 mi) north of the Dead Sea, have revealed remains of the oldest city yet discovered by archaeologists. The earliest occupation of the site, dating from the 10th millennium BC, consists of remains of the NATUFIAN culture and includes what may have been a shrine. During the 8th millennium BC the site was greatly expanded under a culture known as the Aceramic, or Prepottery Neolithic A, and a wall 5.2 m (17 ft) high was erected around it. On the west side were found remains of a round tower 7 m (23 ft) high, with an internal flight of steps.
Natufian is the name given an early prepottery Neolithic culture of the Levant dating from about 10,500 to 8500 BC. It was first identified (1928) in the valley of Wadi en Natuf in Israel. Major sites have since been found in many parts of Israel and Jordan and in Syria. The culture of the Natufians marks a significant break with Late Paleolithic cultures following the close of the Pleistocene Epoch.
Most have been found to have huge flood layers in prehistoric times. Halleys Bible Handbook.
Divided earth?
Gen 10:25. At about the same time, Peleg, a descendant of Shem, was born. Peleg means division. He was named this because in his time the earth was divided. Most Biblical scholars think this reference is to the division of tongues at the tower of Babel. Gen 11. However if you wish to take a literal interpretation of this verse, Britain was separated from the continental landmass after the mid 8th millennium BC.
Star Carr, the first adequately recorded MESOLITHIC site found in Great Britain, is located 8 km (5 mi) south of Scarborough, in Yorkshire, England. Radiocarbon dating indicates that the site was occupied during the mid-8th millennium BC, a period during which Britain was still connected to the continental landmass. This fact would account for the site's affinities with other Maglemosian assemblages of northern Europe.
The Flood
Gen 7:11. The flood during Noah’s time was passed down by word of mouth to many prehistoric cultures indicating the greatness of the event. Many sites around the world show evidence of a tremendous flood during the same period of time. Notable sites that are remarkably similar are at Ur, Kish, Fara, and Nineveh. All of these cities had layers of occupation followed by 5 to 8 feet of clean water laid clay, followed by further layers of prehistoric occupation.
Bronze age
In Gen 4:22 we find that a descendent of Cain, Tubal-Cain, forged tools out of bronze and iron. The Bronze Age up until a few years ago had been considered to begin about 2500 BC with the Egyptians. Now archeology tells us that bronze metallurgy was first practiced in the ore-rich highlands of eastern Anatolia, more than 10,000 years ago.
The Bronze Age is the stage of prehistoric cultural development when BRONZE, an alloy of copper and tin, first came into regular use in the manufacture of tools, weapons, and other objects. It marks the transition between the NEOLITHIC Penis EnlargementRIOD (a phase of the Stone Age), when stone tools and weapons were predominant, and the succeeding IRON AGE, when the large-scale use of various kinds of metals was introduced.
Metallurgy was first practiced in the ore-rich highlands of eastern Anatolia, more than 10,000 years ago. Initially, during what is termed the CHALCOLITHIC ("copper-stone") Period, metals such as copper were treated like stone and beaten into shape with stones. The earliest known artifacts produced by the SMELTING of copper date from about 3800 BC at the site of Tepe Yahya, Iran. The bronze produced there presumably resulted from an accidental blending of copper with other metals, thus forming a new mixture with better properties than copper alone.
Where exactly is eastern Anatolia? Turkey. In Gen 2:10 we find the Garden of Eden located at the headwaters of four rivers. Now certainly the geologic contours of this land has changed over the centuries but four rivers can still be found to drain the area of eastern Anatolia.

Turkey is an independent republic occupying a region, partly in Europe and partly in Asia, that has played a major role in world history as a bridge connecting East and West. European Turkey, known as eastern THRACE, is bounded on the north by the BLACK SEA and Bulgaria and on the west by the AEGEAN SEA and Greece. It is separated from Asian Turkey (ANATOLIA or Asia Minor) by the BOSPORUS, the Sea of MARMARA, and the DARDANELLES Strait. Anatolia is bounded on the north by the Black Sea; on the east by Georgia, Armenia, and Iran; on the south by Iraq, Syria, and the Mediterranean Sea; and on the west by the Aegean Sea.
The eastern highlands are dotted with peaks reaching elevations of 3,000-4,500 m (10,000-15,000 ft) and surrounded by high lava-covered plateaus. The highest of the peaks is Mount ARARAT (Agri Dagi; 5,122 m/16,804 ft), in the extreme east. Vast stretches of the highlands consist of barren waste. Lake VAN is a large salt lake with underground connections to the Tigris and Euphrates rivers, whose headwaters rise in the nearby mountains.
Farming
Gen 1-2. With Adam after the first sin man is introduced to farming. Gen 3-17. Also God gave Adam livestock, the first domesticates. Gen 1:24. Archeology tells us that about 10,000 years ago man domesticated plants and animals. This occurred in western Asia.
In MESOPOTAMIA, the region between the Tigris and Euphrates rivers in present-day Iraq (see FERTILE CRESCENT), cultivation began in the 9th millennium BC. The wheel was invented, pulleys were used to draw water from artificial canals, and complex IRRIGATION systems were constructed. Mesopotamians raised wheat and other cereal grains; were skilled in gardening; and domesticated the camel, donkey, and horse.
Already in late prehistoric times, occupation by cave dwellers in various subregions set the stage for Anatolia's emergence as a center of the agricultural revolution identified with the Neolithic Period. Villages and towns of this era appear at Siirt, Diyerbakir, and Urfa (southeastern Anatolia); Tarsus and Mersin in the Cilician Plain; the Amuq Plain; CATALHUYUK (southeast of Konya); Hacilar (southwestern Anatolia); and Suberde (southwest of Konya). The 13-ha (32-acre) site at Catal Huyuk (c.7000-5600 BC) has produced outstanding artifacts revealing it as a metalworking, specialized-craft, and religious center.
In some areas humans adapted in a markedly different way to the end of the glaciation. Rather than diversifying their use of resources, as the Mesolithic people of the northern woodlands were doing, they focused their attention on a few reliable resources. The land to the east of the Mediterranean was one such area with evidence of this new orientation. Here some populations began to concentrate on exploiting wild sheep and goats and a few species of wild grasses that produced edible seeds. Gradually, as revealed in the archaeological record, a mutual dependence developed between the human populations and the animals and plants they exploited and protected. The favored species, breeding under human protection, became modified so that they could not have survived without it. The humans, in turn, living in permanent settlements near the resources they exploited and tended, could not easily revert to nomadic hunting. The people had become farmers, and the animals and plants, domesticates.
Western Asia is the best-known, and perhaps the earliest, center of domestication.

Man
The Bible says that man was created (bara - something from nothing) on the sixth day Gen 1:26. Evolution says that man slowly evolved from primates beginning 65 million years ago through several species reaching modern man about 10,000 years ago.
Since the discovery at Cro-Magnon, additional human skeletons have been found at a number of European sites, including GRIMALDI, Italy; Chancelade, France; and DOLNI VESTONICE and Predmost, in the Czech Republic. These human remains do not differ significantly from those discovered at Cro-Magnon, and this name is now generally employed in referring to all such anatomically modern humans found in Europe and the Middle East, from their rather sudden appearance about 40,000-30,000 years ago to the end of the Pleistocene Epoch, some 10,000 years ago.
In contrast to the earlier NEANDERTALERS, the Cro-Magnons, who are classified as Homo sapiens sapiens, possessed such modern human features as higher, more vertical foreheads--indicating a modern configuration of the frontal lobes of the brain--reduced brow ridges, smaller faces and teeth, and a chin.
The anatomy of these early modern humans was not identical, however, to that of present Europeans in all respects. Their skeletons show greater muscularity, suggesting they were employed in much more strenuous activities than those of most modern peoples, and among the skeletal finds skull features vary considerably. At the Czechoslovakian site of Predmost, for example, where some 20 skeletons were excavated from a common grave, certain skeletal remains are clearly modern in appearance, but others possess features very similar to those of the Neandertalers.
The Neandertalers (Homo sapiens neanderthalensis) were a widespread subspecies of PREHISTORIC HUMANS that inhabited Europe and parts of Asia and North Africa from about 125,000 to about 40,000 years ago, immediately prior to the appearance of anatomically modern humans (Homo sapiens sapiens) throughout the world.
Until recently, this is where evolution and the Bible parted company. There is simply no way that the Biblical creation and that part of science known as human evolution can be analyzed and shown to be able to coexist. Then in 1997, scientist analyzing the DNA of a Neandertaler revealed something remarkable; Neandertalers are in no way related to any modern humans. The chain which for years was taught in schools and universities to millions of students and illustrated in countless charts showing the progression from apelike creatures (homo erectus) through various stages to neanderthal, cro-magnon, and finally modern man has finally been scientifically destroyed.
Neanderthals-the brawny enigmas who mysteriously disappeared 30,000 years ago after coexisting with modern humans in Europe for tens of thousands of years-were not close relatives or even ancestral forms of existing people, a new study has found.
Instead, unprecedented DNA tests on a famous Neanderthal skeleton indicate that the creatures were almost certainly a separate species that contributed little, and probably nothing, to the present human gene pool.
Utilizing revolutionary DNA technologies, the oldest tie to prehistoric man only goes back 10,000 years.
Using DNA from a tooth, scientists at Oxford University have established a blood tie between a 9000 year-old skeleton known as Cheddar Man and Adrian Targett, an English school teacher. Targett lives in the town of Cheddar, just a half-mile from the cave where the bones were found. It is the longest human lineage ever traced.
"They would have shared a common ancestor 10,000 years ago," said Bryan Sykes, leader of the research team, "so they are related, just not very closely."
To scientists the Bible is accurate in every instance recorded except for the creation of life. But has science proved that anything was alive during the time the Biblical creation occurred? No! The longest unimpeachable incidence found on the entire earth for continuing life is the bristlecone pine tree at 8700 years (6700 B.C.).
Analyzing core samples from living pines and preserved wood from longdead trees, researchers have developed a bristlecone pine tree-ring chronology dating back some 8,700 years.
The age of a living bristlecone pine is determined by using a hand-operated drill (increment borer) to remove a core of growth that can be microscopically examined to determine the width of the annual rings. Carbon-14 dating is also used on this material, although different results may be obtained.
The next section will show why the earth was formless and void.
Ice Age
In comparing what science says to the Bible, the last fact in this reverse chronology that can be examined is before the time of the Lords work in Gen 1:3. Gen 1:1. "In the beginning God created the heavens and the earth. Now the earth was formless and empty, darkness was over the surface of the deep, and the Spirit of God was hovering over the waters." The bible says that the earth was formless and empty (there was no order, chaos, nothing was alive), it was dark, there was water which the spirit of God was hovering over.
Science approximately ten thousand years ago records the end of the last ice age.
The Recent, or Holocene, Epoch is the younger major subdivision of the Quaternary Period. After the last Pleistocene Epoch glaciation, an interglacial interval of warming followed, causing the glaciers to withdraw (see GLACIER AND GLACIATION; ICE AGES). This marked the beginning of the Recent Epoch. The rate of decay shown by radiocarbon (carbon 14) occurring in early Recent wood, peat, shells, and bones indicates that the Recent Epoch began approximately 10,000 years ago.
What was the earth like before the last ice age and what was it like after the last ice age? Remember, before the last ice age we had a far different population of creatures and vegetation inhabiting the earth including mammoths, mastodons, and cro-magnon man. Research has shown that temperatures in tropical regions were below zero for a long time. In a presentation given in the Rayburn House Office Building on September 18, 1995, Dr. Lonnie G. Thompson (Ohio St University) and Dr. Michael Bender (University of Rhode Island) presented some impressive findings.

Dr. Thompson's work focuses on the climate record from tropical and subtropical glaciers. He and his colleagues have drilled and analyzed ice cores from the high mountains of Huascaran, Peru. These cores provide the very first tropical record of global and tropical climate change extending back 20,000 years. Their results show that glacial temperatures at high elevations in the tropics during the peak of the Earth's last ice age were 8o to 12o C. cooler than today. Previously, scientific results, based upon the record of climate change from tropical marine sediment cores, that suggested temperatures in the tropics varied little between an ice age and a period of global warming. However, these new data indicate that the tropical Atlantic was probably 5o to 6o C. cooler during the last ice age.


Converting to the Fahrenheit scale(deg F=9/5 deg C+32); the tropical Atlantic was probably 122-140 degrees F cooler than today. Since the average annual temperature for various parts of Peru range from 65-77 degrees F, the Ice Age conditions must have been uninhabitable. Unless the world shifted on it’s axis, the more temperate areas would have been even colder. Scientists can give no reasonable explanation for why these fluctuations occurred.

Some trigger mechanism, most likely from outside the Earth or its atmosphere, affecting the climate seems to be necessary. Solar energy intensities have not yet been found to vary sufficiently to have single-handedly produced an ice age, but solar activity as expressed in sunspots and radio blackouts on an 11-year cycle has been shown to relate to short-term fluctuations in the Earth's climate. Longer cycles are currently being sought by statistical means.


Then the earth went from a land that was uninhabitable to an earth of present day plants and animals and man in the space of a few centuries. The animals and plants and humanoids before this time were of a different type. We will never know for sure what the earth was like 10 to 12 thousand years ago, but science does know:
1) It was cold (no light?). Can science prove there was light at this time?
2) It was covered with water (ice). Temperatures in the tropical Atlantic were 122-140 degrees F less than the present.
The continental glaciers became very thick. Today more than half of the Antarctic ice sheet is more than 2,500 m (8,200 ft) thick; in central Greenland the ice is 2,000 m (6,600 ft) thick in most places. These have been measured by two drill holes, by seismic (wave) sounding, by radio-echo sounding, and by precise gravity measurements. Thickness has also been calculated by using a formula involving primarily the temperature of the basal ice and the slippage at the bottom. Similar calculations applied to the much larger Pleistocene ice sheets indicate that these were over 3,000 m (10,000 ft) thick in North America and 2,500 m (8,200 ft) thick in Europe. These thicknesses are independently confirmed by the isotopic ratios of oxygen, which differ between rainfall and snowfall ice; the oxygen isotopes of microfossil sediments that fell to the seafloor during the colder stages of Quaternary time indicate that the thickness of the ice averaged 2,500 m (8,200 ft) much of the time.
3) And science can not prove that anything was alive at that time. At least 99.9 percent of the species that have ever lived are now extinct.
Approximately 2 million different species of organisms are now living, but it is estimated that at least 99.9 percent of the species that have ever lived are now extinct and that some 2 billion species have evolved during the past 600 million years.
The Bible record matches the archaeological record all the way back to the first two chapters of Genesis and provides an unimpeachable record for creation in Gen 1:1. The Bible was written by ancient people without the virtue of modern science. Why should modern man question the first two chapters when it is correct thereafter? As we shall see, evolution requires much more faith.

Formation of our universe and earth. "In the Beginning"…


Science tells us that our universe was smaller than a grain of mustard seed 10.7 billion years ago. This "singularity" was infinitely dense as well as infinitely small and consisted of pure energy. Then a process called the big bang occurred in which all of this matter exploded beginning the history of the universe and which they calculate is still progressing. If I had to imagine how God created our universe, I believe that I would say as in Gen 1:1 that He created something from nothing and the story of the big bang would not be to far off. Matt 13:31, Mark, Luke.

After the big bang the question of how our earth was formed and how it came to its’ current position should be addressed. Was this just a random act? Why have none of the planets in our solar system or others shown any properties such as ours necessary for life. What are the odds that a planet like earth would have randomly occurred?

Distribution of elements. Hydrogen, oxygen and carbon are the essential elements for life. Earth is the only body found with anything close to sufficient amounts of these elements to produce life. If during the process of nucleosynthesis, anything would have happened even slightly differently, we could not exist. The timing had to be perfect.

Existence of gases. Earth for some reason had not yet expelled gases contained in the core at the time of massive solar winds produced by the sun. Therefore when volcanic activity started, the earth had the ingredients to form an atmosphere.

Distance from the sun. Venus is only 30% closer to the sun than earth, but the surface temperature average is 500 degrees C. The earth’s path around the sun only varies by 3%. If it was seven percent, water vapor could not condense. No other observed bodies have such a perfect orbit.

UV radiation. In order for life to occur, the earth must be close enough to absorb heat from the sun. However at this distance, UV radiation would kill all life. Radiation striking oxygen to produce ozone which shields the earth allows life to be sustained. Science tells us that the early earth had no free oxygen in which to produce ozone. Oxygen was produced by the first plants.

Magnetic field. Without a magnetic field, earth would be exposed to lethal doses of cosmic radiation. This field is produced by the movement of the earth’s molten core. Scientists can not explain the cause of the field.

There are many more significant things which had to happen in the formation of earth in order to create life. While there are billions of other stars with billions of other planets, the odds that a sequence of events happening to produce a habitable planet are beyond human calculation.

Has our sun been burning for 4.65 billion years? If so the sun would have been so large so as to absorb Mercury and Venus and prohibit life as we know it on earth. Also the sun and stars are composed mainly of hydrogen. During the fusion reaction, two hydrogen atoms are fused to produce helium and heat. If the universe is truly over 10 billion years old, we should have almost all helium. However the universe is composed of almost all hydrogen.

Science Vs. Science: How science has discredited itself .

The evolution of evolution

A brief discussion of how evolution is supposed to work.
In the 1890`s Darwin formed his Theory on the origin of the species. At that time the documented fossil record was incomplete (as it remains today). Up until this time scholars thought the earth was about 6000 years old. Darwin and other scientists realized that many species had traits in common. Darwin theorized that if species were able to change over time (some good, some bad), then the changes that proved to be advantageous would cause the recipients of the changes to thrive (natural selection). Scientists later attributed the cause of these changes to genetic mutations. They further realized that millions of years would be needed for this process to occur. Therefore they set out to prove the earth was very old. Along the way many sub-theories have been postulated and disproved. Simplistically, the following describes where most evolutionists now stand. Most agree that spontaneous generation occurred and then ?.

Spontaneous Generation. Inorganic matter magically forms organic matter in a primordial soup. DNA and other long chain amino acids are able to form against all odds.
Gradual evolution. Slow steady changes over millions of years through mutations and natural selection brings about new species. Over the years most scientists realized this was not what happened and have disavowed it.
Punctuated Equilibrium. Thousands of years of stasis followed by a remarkable change (positive mutations) followed by another period of stasis.
Neither? Almost as many theories have been proposed as there are species alive today. Most are based on a form of gradual or punctuated.

What exactly has been found in the fossil record?

One hundred and twenty years after Darwin developed his theory not one "link" has come to light. In fact as more research is done, more gaps seem to appear in the chain and more questions are posed. Of course, a scientist without a question to answer can be described in one word; unemployed.

The fossil record seems to have revealed a series of global catastrophes which has appeared to essentially destroy most if not all life, followed by different or new species appearing magically. The two most popular of these periods are the destruction of the dinosaurs and the last ice age when mastodons etc. were destroyed. There is no species which can be traced for millions of years of change. They live and then they die.

Unanswered questions for the evolutionist.

1. How can life ever have begun from nonliving matter? Amino acids can not join in the presence of oxygen. If there was no oxygen, there would be no ozone layer and UV radiation would kill any life. Further, long chain amino acids cannot be formed in water.
2. What came first. The enzyme or DNA? Specific enzymes are needed in order to replicate DNA. However the instructions for making these enzymes are located on the DNA.
3. Why are there no primitive cells either today or in the fossil record?

PRIMATIVE CELL? J. MONOD........ we have no idea what the structure of a primitive cell might have been. The simplest living system known to us, the bacterial cell .... in .... its overall chemical plan is the same as that for all other living beings. It employs the same genetic code and the same mechanism of translation as do for example, human cells. Thus the simplest cells available to us for study have nothing 'primitive' about them .... no vestiges of truly primitive structures are discernible. " .

SOURCE OF INFORMATION??? CARL SAGAN Cornell, "The information content of a simple cell has been estimated as around 10 to the 12th power bits, comparable to about a hundred million pages of the Encyclopedia Britannica."

RICHARD DAWKINS, Oxford, "Some species of the unjustly called primitive' amoebas have as much information in their DNA as 1000 Encyclopedia Britannicas.

CELL? MICHAEL DENTON Molecular Biologist (Agnostic), "To grasp the reality of life as it has been revealed by molecular biology, we must magnify a cell a thousand million times until it is twenty kilometers in diameter and resembles a giant airship large enough to cover a great city like London or New York. What we would then see would be an object of unparalleled complexity and adaptive design. On the surface of the cell we would see millions of openings, like the portholes of a vast space ship, opening closing to allow a continual stream of materials to flow in and out. If we were to enter one of these openings we would find ourselves in a world of supreme technology and bewildering complexity.... Is it really credible that random processes could have constructed a reality, the smallest element of which functional protein or gene - is complex beyond our own creative capacities, a reality which is the very antithesis of chance, which excels in every sense anything produced by the intelligence of man?"

4. What are the statistical odds that a primitive cell could be formed randomly? Again, scientists say the solar system is 4.6 billion years old. They say life began 3.5 billion years ago. Therefore it took 1.1 billion years to randomly form life. The simplest protein molecule of the simplest primitive cell has 400 linked amino acids, each composed of 4-5 chemical elements. If only 100 elements are considered, the odds of these elements randomly coming together to form a single protein are 1 in 10 to the 158 power. There are only 10 to the 80 power electrons in the universe! If you had one billion attempts per second, for thirty billion years to make a 100 amino acid protein, the odds of success is 1 in 10 to the 53 power. The probability of chance formation of the DNA for a simple self replicating organism has been calculated at 1 in 10 to the 167,636 power. What about the odds of forming a brain?
5. Where did the variety of life found in the Cambrian period (500-570 million years ago) come from? Life went from simple worm like creatures to all the major animal groups in a period of zero to ten million years.
6. Why have no new Phyla been produced in 500 million years? Why were they all produced at one time?

STEPHEN GOULD, Harvard,"…one outstanding fact of the fossil record that many of you may not be aware of, that since the so called Cambrian explosion ... during which essentially all the anatomical designs of modem multicellular life made their first appearance in the fossil record, no new Phyla of animals have entered the fossil record.", Speech at SNW, Oct.2, 1990

RICHARD MONASTERSKY, Earth Science Ed., Science News, "The remarkably complex forms of animals we see today suddenly appeared ... this moment, right at the start of the Earth's Cambrian Period…marks the evolutionary explosion that filled the seas with the earth's first complex creatures....'This is Genesis material,' gushed one researcher .... demonstrates that the large animal phyla of today were present already in the early Cambrian and that they were as distinct from each other as they are today ... a menagerie of clam cousins, sponges, segmented worms, and other invertebrates that would seem vaguely familiar to any scuba diver."

RICHARD DAWKINS, Cambridge, "JM we find many of them already in an advanced state of evolution, the very first time they appear. It is as though they were just planted there, without any evolutionary history. Needless to say, this appearance of sudden planting has delighted creationists .... the only alternative explanation of the sudden appearance of so many complex animal types in the Cambrian era is divine creation......

H.S. LADD, UCLA, "Most paleontologists today give little thought to fossiliferous rocks
older than the Cambrian, thus ignoring the most important missing link of all. Indeed the
missing PreCambrian record cannot properly he described as a link for it is in reality,
of life: the first ninetenths."

Penis EnlargementRCY E. RAYMOND, Prof of Paleontology, Harvard, "It is evidence that the oldest Cambrian fauna is diversified and not so simple, perhaps, as the evolutionists would hope to find it. Instead of being composed chiefly of protozoa’s, it contains no representatives of that phylum but numerous members of seven higher groups are present, a fact which shows that the greater part of the major differentiation of animals had already taken place in those ancient times."

7. Assuming we did evolve from nothing, how did sexual reproduction begin? Two totally compatible beings had to evolve at the same time in the same place with all systems functioning or one being had to split into two compatible beings ready to function!
8. Why do species appear completely developed and stay that way?

CHANGE PREVENTED, S. M. STANLEY, Johns Hopkins Univ. "Once established, an average species of animal or plant will not change enough to be regarded as a new species, even after surviving for something like a hundred thousand or a million, or even ten million generations... Something tends to prevent the wholesale restructuring of a species, once it has become well established on earth."

VARIATION, NOT IMPROVEMENT, STEPHEN T. GOULD, HARVARD, We can tell tales of improvement for some groups, but in honest moments we must admit that the history of complex life is more a story of multifarious variation about a set of basic designs than a saga of accumulating excellence.

CONFESSION, CHARLES DARWIN, "There are two or three million species on earth. A sufficient field one might think for observation; but it must be said today that in spite of all the evidence of trained observers, not one change of the species to another is on record."

CHARLES DARWIN, "If it could be demonstrated that any complex organ existed which could not possibly have been formed by numerous, successive, slight modifications, my theory would absolutely break down."

9. How have mutations created the variety of life we see today? Over 99 percent of induced mutations are defects. No mutant has ever been observed that crossed the line to another species.

PROFESSOR G.G. SIMPSON, one of the elite spokesmen for evolution, writes about multiple, simultaneous mutations and reports that the mathematical likelihood of getting good evolutionary results would occur only once in 274 billion years. That is assuming 100 million individuals reproducing a new generation every day. "Obviously such a process has played no part whatever in evolution."

MICHEL DELSOL, PROF. OF BIOLOGY, UNIV. OF LYONS, "If mutation were a variation of value to the species, then the evolution of drosophila should have proceeded with extreme rapidity. Yet the facts entirely contradict the validity of this theoretical deduction; for we have seen that the Drosophila type has been known since the beginning of the Tertiary period, that is for about fifty million years, and it has not been modified in any way during that time."

10. How can evolution explain symbiotic relationships?
11. How did the first life form defy the 2nd law of Thermodynamics. All things tend toward chaos. Disintegration of an organic compound is much more likely than random formation.
12. Where are all the people? Science says that man has been on the earth for 2.5 million years. Population statisticians have calculated that if man has been here for one million years and considering wars, famines, disease, a 45 year life span and conservative reproduction (2.5 children), there should be 10 to the 5000 power people on earth today. The known universe would only hold 10 to the 100 power people. Using the same statistics, in 6000 to 8000 years you would have 5 billion people.
13. Where are the precursors to winged creatures? There should be fossilized creatures that are similar to birds, bats, and insects without the advanced ability to fly.

Additional quotes from scientists.

Yet even the staunchest supporters of "Out of Africa" (a theory which says all modern humans evolved from Africa millions of years ago) concede that the issue is still unresolved. As Ian Tattersall, an evolutionary biologist and head of the anthropology department at the American Museum of Natural History in New York, explains, "The emergence of Homo sapiens is
still the really big mystery in human evolution."

MUTATIONS IRREVELANT, STEPHEN T. GOULD, Harvard, "A mutation doesn't produce major new raw material. You don't make a new species by mutating the species. ...That's a common idea people have; that evolution is due to random mutations. A mutation is NOT the cause of evolutionary change." Lecture at Hobart and William Smith College, 14/2/1980

TEXTBOOK EVOLUTION DEAD, STEPHEN. T GOULD Harvard, "I we] I remember how the synthetic theory beguiled me with its unifying power when I was a graduate student in the mid -1960's. Since then I have been watching it slowly unravel as a universal description of evolution ... I have been reluctant to admit it - since beguiling is often forever - but if Mayr's characterization of the synthetic theory is accurate, then that theory as a general proposition, is effectively dead, despite its persistence as textbook orthodoxy." .

IMPLICATIONS OF INTEGRITY, FRANCIS CRICK, "An honest man, armed with all the knowledge available to us now, could only state that in some sense, the origin of life appears at the moment to be almost a miracle, so many are the conditions which would have had to have been satisfied to get it going."

SEPARATE LIVING KINDS, STEPHEN JAY GOULD, Harvard, "Our modem phyla represent designs of great distinctness, yet our diverse world contains nothing in between sponges, corals, insects, snails, sea urchins, and fishes (to choose standard representatives of the most prominent phyla)."

SEPARATE FOSSIL KINDS, Valentine (U. CA) & Erwin (NH St.), "If we were to expect to find ancestors to, or intermediates between higher taxa, it would be the rocks of the late Precambrian to Ordovician times, when the bulk of the worlds higher animal taxa evolved. Yet traditional alliances are unknown or unconfirmed for any of the phyla or classes appearing then." .

"TREES" NOT FROM FOSSILS, S. J. GOULD, Harvard, "The evolutionary trees that adorn our textbooks have data only at the tips and nodes of their branches; the rest is inference, however reasonable, not the evidence of the fossils."

STORY TIME, COLIN PATTERSON, Senior Paleontologist, British Museum of Nat. History, "You say I should at least show a photo of the fossil from which each type of organism was derived. l will lay it on the line-there is not one such fossil for which one could make a watertight argument." "It is easy enough to make up stories of how one form gave rise to another. ... But such stories are not part of science, for there is no way of putting them to the test. ... I don't think we shall ever have any access to any form of tree which we can call factual."

UNRELATED LOOKALIKES, J.Z. YOUNG, Prof of Anatomy, Oxford, "....similar features repeatedly appear in distinct lines. ...Parallel evolution is so common that it is almost a rule that detailed study of any group produces a confused taxonomy. Investigators are unable to distinguish populations that are parallel new developments from those truly descended from each other."

INTERPRETATION OF SIMILARITY, T.H. MORGAN Prof Zoology, Columbia, Univ., "If, then, it can be established beyond dispute that similarity or even identity of the same character in different species is not always to be interpreted to mean that both have arisen from a common ancestor, the whole argument from comparative anatomy seems to tumble in ruins."

NONGENETIC SIMILARITY, SIR GAVIN DEBEER, Prof. Embry., U. London, Director BathmateNH, "It is now clear that the pride with which it was assumed that the inheritance of homologous structures from a common ancestor explained homology was misplaced; for such inheritance cannot be ascribed to identity of genes. The attempt to find homologous genes has been given up as hopeless."

BOTHERSOM DISTRESS, STEPHEN J. GOULD, Harvard, Lecture at Hobart & William Smith College, 14/2/1980. "Every paleontologist knows that most species don't change. That's bothersome .... brings terrible distress. ...They may get a little bigger or bumpier but they remain the same species and that's not due to imperfection and gaps but stasis. And yet this remarkable stasis has generally been ignored as no data. If they don’t change, its not evolution so you don’t talk about it."

DESIGNS, S.J. GOULD, Harvard, "We can tell tales of improvement for some groups, but in honest moments we must admit that the history of complex life is more a story of multifarious variation about a set of basic designs than a saga of accumulating excellence .... I regard the failure to find a clear 'vector of progress' in life's history as the most puzzling fact of the fossil record .... we have sought to impose a pattern that we hoped to find on a world that does not really display it."

DARWIN'S BIGGEST PROBLEM, "....innumerable transitional forms must have existed but why do we not find them embedded in countless numbers in the crust of the earth? .... why is not every geological formation and every stratum full of such intermediate links? Geology assuredly does not reveal any such finely graduated organic chain, and this perhaps is the greatest objection which can be urged against my theory".

MORE EMBARRASSING, DAVID M. RAUP, Univ. Chicago; Chicago Field Mus. of N.H., "The evidence we find in the geologic record is not nearly as compatible with darwinian natural selection as we would like it to be. Darwin was completely aware of this. He was embarrassed by the fossil record because it didn't look the way he predicted it would.... Well, we are now about 120 years after Darwin and the knowledge of the fossil record has been greatly expanded. We now have a quarter of a million fossil species but the situation hasn't changed much. ...ironically, we have even fewer examples of evolutionary transition than we had in Darwin's time. By this I mean that some of the classic cases of darwinian change in the fossil record, such as the evolution of the horse in North America, have had to be discarded or modified as the result of more detailed information."

GOOD RECORD-BAD PREDICTION, NELES ELIDRIDGE, Columbia Univ., American Museum of Nat. Hist., "He [Darwin] prophesied that future generations of paleontologists would fill in these gaps by diligent search. ... One hundred and twenty years of paleontological research later, it has become abundantly clear that the fossil record will not confirm this part of Darwin's predictions. Nor is the problem a miserably poor record. The fossil record simply shows that this prediction was wrong."

THE HORSE "STORY", COLIN PATTERSON, Senior Paleontologist British Museum of Natural History, "There have been an awful lot of stories, some more imaginative than others, about what the nature of the history [of life] really is. The most famous example, still on exhibit downstairs, is the exhibit on horse evolution prepared perhaps fifty years ago. That has been presented as the literal truth in textbook after textbook. Now I think that that is lamentable, particularly when the people who propose those kinds of stories may themselves be aware of the speculative nature of some of that stuff."

STORY TIME OVER, DEREK AGER, Univ. at Swansea, Wales, "It must be significant that nearly all the evolutionary stories I learned as a student ... have now been 'debunked’. Similarly, my own experience of more than twenty years looking for evolutionary lineage's among the Mesozoic Brachiopoda has proved them equally elusive."

REPTILE TO BIRD W.E. SWINTON, "The origin of birds is largely a matter of deduction. There is no fossil evidence of the stages through which the remarkable change from reptile to bird was achieved."

ORDERS, CLASSES, & PHYLA, GEORGE GAYLORD SIMPSON, Harvard, "Gaps among known species are sporadic and often small. Gaps among known orders, classes, and phyla are systematic and almost always large. "

GENUINE KNOWLEDGE, D.B. KITTS, University of Oklahoma, "Despite the bright promise that paleontology provides a means of "seeing" evolution, it has presented some nasty difficulties for evolutionists, the most notorious of which is the presence of 'gaps' in the fossil record. Evolution requires intermediate forms between species and paleontology does not provide them... The 'fact that discontinuities are almost always and systematically present at the origin of really big categories' is an item of genuinely historical knowledge."

NOT ONE ! D. S. WOODROF'F, Univ. of CA, San Diego, "But fossil species remain unchanged throughout most of their history and the record fails to contain a single example of a significant transition."

EVIDENCE A MATTER OF FAITH, A.C. SEWARD, Cambridge, "The theoretically primitive type eludes our grasp; our faith postulates its existence but the type fails to materialize."

"WE KNEW BETTER", NILES ELDREDGE, Columbia Univ., American Museum Of Natural History, "And it has been the paleontologist my own breed who have been most responsible for letting ideas dominate reality: .... We paleontologist have said that the history of life supports that interpretation [gradual adaptive change], all the while knowing that it does not."

"UNEMBARRASSED", GOULD & ELDREDGE, "In fact, most published commentary on punctuated equilibria has been favorable. We are especially pleased that several paleontologists now state with pride and biological confidence a conclusion that had previously been simply embarrassing; 'all these years of work and I haven t found any evolution. (R.A. REYMENT Quoted) "The occurrences of long sequences within species are common in boreholes and it is possible to exploit the statistical properties of such sequences in detailed biostratigraphy. It is noteworthy that gradual, directed transitions from one species to another do not seem to exist in borehole samples of microorganisms." (H.J. MACGILLAVRY Quoted) "During my work as an oil paleontologist I had the opportunity to study sections meeting these rigid requirements. As an ardent student of evolution, moreover, I was continually on the watch for evidence of evolutionary change. ...The great majority of species do not show any appreciable evolutionary change at all. These species appear in the section (first occurrence) without obvious ancestors in underlying beds, and are stable once established."

PUNCTUATED EQUILIBRIUM, S.M. STANLEY, Johns Hopkins U. "The record now reveals that species typically survive for a hundred thousand generations, or even a million or more, without evolving very much. We seem forced to conclude that most evolution takes place rapidly ... a punctuational model of evolution ... operated by a natural mechanism whose major effects are wrought exactly where we are least able to study them in small, localized, transitory populations. ...The point here is that if the transition was typically rapid and the population small and localized, fossil evidence of the event would never be found."

PUNCTUATED EQUILIBRIUM? COLIN PATTERSON, British Mus. of N. H., "Well, it seems to me that they have accepted that the fossil record doesn't give them the support they would value so they searched around to find another model and found one. ...When you haven’t got the evidence, you make up a story that will fit the lack of evidence. "

INAPPLICABLE TO "KINDS", Valentine (Univ. of CA) & Erwin (MI St. Univ), "We conclude that ... neither of the contending theories of evolutionary change at the species level, phyletic gradualism or punctuated equilibrium, seem applicable to the origin of new body plans. "

PALEONTOLOGY DOES NOT PROVE EVOLUTION, D.B. KITTS, University of Oklahoma, "The claim is made that paleontology provides a direct way to get at the major events of organic history and that, furthermore, it provides a means of testing evolutionary theories .... the paleontologist can provide knowledge that cannot be provided by biological principles alone. But he cannot provide us with evolution."

DON'T USE THE FOSSELS, MARK RIDLEY, Oxford, "...a lot of people just do not know what evidence the theory of evolution stands upon. They think that the main evidence is the gradual descent of one species from another in the fossil record. ...In any case, no real evolutionist, whether gradualist or punctuationist, uses the fossil record as evidence in favor of the theory of evolution as opposed to special creation."

FOSSELS INDICATE CREATION! E.J.H. CORNOR, Cambridge "Much evidence can be adduced in favor of the Theory of Evolution from Biology, Biogeography, and Paleontology, but I still think that to the unprejudiced the fossil record of plants is in favor of special creation."

The homo sapiens who inhabit this earth at this point in time are an extremely lucky species. The Bible is filled with stories of people who had a hard time believing in God and then later in Jesus. In the Old Testament, people worshipped pagan gods and had more faith in them than in the one true God. Then God’s chosen people, the Jews, had a hard time accepting his Son. Even two thousand years later many Jews are still waiting for their Messiah.

Today people are no different than those found in the Bible. There are those who are believers and those who are not. Then there are those who are faithful and those who are not. The Biblical writers foretold of these things. However, due to the sacrifice of God’s Son on the cross we have the ability to be saved. This process starts with the education of the individual. Education is the engine which drives faith. The problem facing homo sapiens today is the quality and amount of education received by the majority of people and how this education influences their faith.

There are many who only hear the old sad theories developed by Darwin and his contemporaries. Some make sense such as natural selection (survival of the fittest). Mutations are a fact of life and are well documented (although positive mutations are almost impossible to document). However to attribute the development of all life as we know it to these phenomenon is a farce. Spontaneous generation is at best a fairy tale. As can be seen by the above quotes, many of the leaders in the fields of evolution, paleontology, microbiology etc. are convinced evolution as proposed simply doesn’t work. The question should be why are these unproved theories still taught (many of which have been totally disproved) and how long will the charade continue?

The short answer as to why is money, and as to how long it will continue is however long scientists in these fields are required to eat. As stated earlier the one absolute requirement for a scientist is to have a question or a problem. If the question or problem is definitively answered, then he better have another ready to be answered. In the field of evolution however, the dissemination of faulty information has far reaching and long lasting consequences. The possibility of destroying the faith of some poor souls simply to make a living might be compared to selling ones soul to the devil. As well the Biblical warnings against false prophets take on all new meanings.

The responsibility for a Biblical education falls on Christians and the Church. On a level playing field studious people can normally see the truths of the Bible and what is expected of them. When the field is tilted by a theory which at the start precludes divine creation, the opportunity for a Biblical education may also be precluded. If the Bible is truly studied, then faith will be developed as a matter of course. It should not have to compete with a mercurial process such as scientific method; once defeated it simply re-theorizes and attacks again carrying the exalted banner of SCIENCE at the front. Christians should not have to worry until the scientific community unanimously proclaims the LAW of evolution. And that day will never come!

The Book was written between nineteen hundred and over five thousand years ago by authors who knew not science from Adam’s off ox. The Words contained therein are as true today as they were then. They are unimpeachable. Some of the most cunning and devious minds the world has produced have tried to perjure those pages and have failed. Anyone can study them and find the way to a satisfying life and a home in heaven. The amount of faith required is much less than for evolutionists.

Sir Julian Huxley, one of histories’ leading proponants of evolution computed the odds of the process of natural selection being able to produce a horse with the benifit of every favorable evolutionary factor. All computations were based on chance development through the operation of nature, time, mutation, and natural selection. In his book Evolution in Action, Huxley gave the odds this way:

"The figure 1 with three million naughts after it; and that would take three large volumes of about 500 pages each, just to print!…No one would bet on anything so improbable happening; and yet it has happened."

Dr. George Wald, Nobel Prize winner of Harvard University, states it as cryptically and honestly as an evolutionist can:

"One has only to contemplate the magnitude of this task to concede that the spontaneous generation of a living organism is impossible. Yet here we are - as a result, I believe, of spontaneous generation."

Now those are two examples of faith; unfounded and misdirected faith. What might their thoughts be if only a small amount of their research time had been spent in Bible study.
 
Hmmm. This is a paper I wrote several years ago. It has been added to as new scientific discoveries have been made. I could not find off hand, my most recent copy.

I copied and pasted this from a word document. Of course, it did not copy true. It might be somewhat hard to tell what I wrote, and what is researched material. The sitings did not make it in the transfer.

If anyone cares, I will upload the actual document that can be opened in Word.

Bigger
 
Dang I read so much hogwash by AC and other people, I wanted to reply to, I think Bib gave em enough to bite into.

AC show me a flaw in the Bible. Yes it was written by men. God chose and divinely inspired each writer and the parts left out were supposed to be left out because God did not choose those parts. The dead sea scrolls among countless secular historical references legitimize the historicity of the Bible. It is proven when it was written. All of the prophecies that followed that occurred you have yet to direct any real opposition to. "Laughable" is all you say.

Well, your defense mechanism of blowing off facts, is what's laughable.

Also I never said the Bible outline or claims string theory.

I am simply saying, all science discoveries so far (and I am predicting to come), either have no relation to the Bible, confirm and corrolate with what is in the Bible, or were already in the Bible and said to be true before scientists accepted it.

String theory corrolates and confirms what is in the Bible. Read Bib's and you will be blown away. BTW Vlad it was 40 days and as I already said about species diversity, it hadn't diversified greatly til after the flood. The numbers most scientists believe about the number of species of air breathing animals (only ones who went on boat), is a number the ark could easily fit.

Vlad - search over the Noah's Ark sites look at the stats and facts.

AC - Saying something is laughable and not addressing it with any facts or retort is a joke in and of itself. Like I said, unless you have facts that counter mine, just don't address them or me in this debate. Thanks.

Also AC, everyone has or will hear about God. It is in the Bible and Christians are commanded to go around the world and preach it. This is how they hear.

Protect their comfort? I for one would never do that, but I see a bit of that going on here. It's amazing how the face of religion could change, even 50 years ago many of those same Religious people would be calling String Theory and all the rest of the info here, crap and completely nothing to do with teh Bible, and in these short years now not only is String Theory part of God, but it was written in the Bible as well?
I see you love to attack the old image of Christianity and try and stick it to the face of Christianity today. People said this, people said that. Who cares who said what, and if they claimed to be Christian. The point is how the facts stand.

As usual an ignorant joking synic, who is also trying to keep his comfort zone through his joker disposition on the matter, will assume things or mishear things on purpose. I said the String Theory corrolates with the Bible. I never said the theory was outlined.

There have been MANY important scientific facts in the Bible, which I provided in link (few if any you have gone too, as you still claim I have no scientific facts), that man didn't discover and believe til many many years later.
 
Sephin and 9cylcops are living in a fantasy world. They use the internet and other creation scientist or "intelligant design"(lol!) to try and pass their religion as science. Its actually hilarious all the misinformation that people use to justify their pre-existing notions.

According to the biblical account, the earth is approximatley 6000 years old. That is fact, based on the biblical time frame. There is one flaw. The bible is a socially constructed, human edited, collection of books put together by many authors over many centuries. The Bible is so vague, that it verses can have multiple interpretations. So for you to say that b/c something is quoted in the bible that it is rock solid proof of a phrophecy is very juvenile. You've obviously never had a class in argumentative reasoning. Your agrument is not "sound".

Believers make the mistake of linking their FAITH and religion with actual factual tense. These are moral stories that are supposed to guide us to being decent and kind to your fellow man. Taking it literally misses the entire point of the bible.

Also thanks for calling me an idiot. Maybe you should look in the mirror when you call people names, and "synic" is spelled "cynic", and you should be more cynical instead of swallowing every load of creation-science (<----oxymoron) that you find on the internet. Dont even try to comparie religion and faith with science. They are completely opposite in their structure. Science involves changes, observations, hypothesis, testing, and debate. Religion or non-science is rigid, ficticous, based on assertions, insisting, and fact twisting.

The definition of a religious fundamentalist is someone who demands a literal interpretation of the bible. Just like are Islamic enemies. Are you gonna join the bandwagon and hopp on the Christian Crusader? Are any believers here, under this definition, a religious fundamentalist?
 
Nice how casey doesn't address Bib. Bib's post is crawling with factual creation science. You keep citing 6,000 years old. Show me this source please.

You still generalize and refuse to address anything I put forward. You just clump it and dump it with pretty much, "All your stuff is fictitious, so I won't address any of it specifically."

According to the biblical account, the earth is approximatley 6000 years old. That is fact, based on the biblical time frame. There is one flaw. The bible is a socially constructed, human edited, collection of books put together by many authors over many centuries. The Bible is so vague, that it verses can have multiple interpretations. So for you to say that b/c something is quoted in the bible that it is rock solid proof of a phrophecy is very juvenile. You've obviously never had a class in argumentative reasoning. Your agrument is not "sound".
Not a fact. If so show me. Bible was never edited, it was written once. The verses have ever so slightly different interpretations ONLY because languages are different.

If you want the original texts you can look back to the Hebrew writings. You make one assumption based on one information. Because the Bible has slightly different interpretations (normally 1-2 words per verse MAX, because they CAN mean something else in another language), you blow them out of proportion and try to discredit the prophecy.

Well guess what. Not only does 1 verse claim a prophecy, in other parts of the Bible multiple verses claim the same one. Think every single verse when the language was translated misinterpreted the whole thing? No.

You are very juvenile. Yet again prove your ignorance of the Bible, flaunt your assuming skills, and dodge any argument me put forward with your holier-than-thou (I laugh at that! - btw excuse the pun) disposition. Cynic your right and yes it is you're I just dont like using 's. Anyhow, let us not make this the grammar/spelling/punctuation police if I am 100% understandable ;)

Remember. When you assume, you make an a-s-s out of u m-e ;)

Now, are you going to address any facts I put forth, or anyone else on my side for that fact? Or are you going to keep stereotyping and flaunting your ignorance of the subject?
 
*yawn* Well AC - join casey and read up on Bib and the rest of the facts. So far you guys have either said "facts" without citations or resources, and just your opinion. Not worth my time going back and forth, everytime you repeat your opinion and stereotypes, to show you facts you will arrogantly toss aside for your comfortable perception of reality.
 
Different time, different Gods - - Exactly AC, exactly.

Only a percentage of all the humans that have ever lived (by the way, the oldest estimates of agriculturaly fueld and literate social society go back to only around 40,000 years, and monotheism likely came out of the desert about 4,000 years ago . . .) have believed in the Christian god. Lucky for them, guess the rest of us are fucked.

Simple fact on religion and science, though it's already been stated in various forms to no response from the religious crew: Religion must place facts and evidence within its own context to make them support its claims, which are not based on fact. Science objectively catalouges and evalutes evidence and observation with no over-arching idelology. Which one has a bias? Which one is contrained by principles not rooted in observation and rationality? Science isn't out to question religion, it just does this naturally by illuminating clear facts about our world and reality. The same can't be said for the other side of the debate. I don't think any scientists have ever tortured and threatened church leaders to get them to renounce their claims. Who is the group threatened here? Scientific rationalists aren't really on the defensive . . . they don't care. If you're religious and feeling threatened by bad old science, ask yourself where the cognitive disonance is coming from.

When you get down to it, there isn't a relgion in the land that isn't fully dependent on what either people have just claimed is the nature of all things, or what a book, written by men, without benefit of science and observation, claims is the nature of all things. Neanderthals buried their dead and have been shown to have believed in a type of afterlife. They weren't human - I don't hear any mention of them in any religious texts.

Hey, any religion could possibly have it all right - sure, it's possible, why the hell not. Is there a single religion that wasn't invented by men over generations in the ancient world that is not built on blind faith and superstition? Nope. What are the odds your religion got it right friends? No religion can escape the fact that it must try and fit the world into its parameters, and hence is at odds with the very fundamental foundations of scientific thought. This basically negates the religious attacks on currently established scientific theory.

Another great thing about science: A scientific theory claims to be the thing we understand to be the most likely to be true - not an absolute. Religion does the opposite, claims a stranglehold on the truth, and because it can't budge, it must mangle reality in order to justify its claims.

Is there a god? Damn, that would be awsome, how interesting, perhaps one day I'll get to find out. Are we tiny little humans god's true and chosen creation amongst the universe, each with a special destiny and selected above all other things by this multi-dimensional omni-intelligence for no particular reason, except ostensibly some kind of cosmic ant farm? Uh . . . oh wait he works in mysterious ways. Don't ask questions! Questions complicate things don't they?
 
VladtheImpaler said:
The Ark doable, yeah I think not......1 000 000 species, again no way.....we have still not discovered like 60% of the animal kingdom (given most are insects, but still)

How do you feed these animals for 60 days(Carnivores too)?
How do you make sure they dont mangle each other?
How do you build a boat that has to be like 100 times the size of an oceanliner???
How do you round up all the animals??
Where does all this wood come from?
Who builds the boat??? Noah??
1. hay there was no canivors before the flood
2. stalls
3. took 120 years
4. you let GOD do it
5.trees
6.yes go back to Genesis and read it
7. btw it had no rudder as it had nowhere to go
 
*yawn* same old same old. More opinion and stereotypes. Religion is this. Religion is that. Christian people are like this and like that.

Dont attack the messenger attack the message. And as I already said the Bible was divinely inspired because the hundreds of prophecies in it that came true. It is a mathematical impossibility it was a guess.

I can just as easily say, as you do, you bend the facts from what they are, so they then dont corrolate with Christianity, so you can hold on to not believing in it.

No religion can escape the fact that it must try and fit the world into its parameters, and hence is at odds with the very fundamental foundations of scientific thought. This basically negates the religious attacks on currently established scientific theory.
Very funny. Like I said. Science just justifies the Bible. Religion this and that. I am talking about Christianity and the Bible. The Bible fits into the parameters of science, without distorting, bending, or denying any scientific facts.

The only "science" Christianity ever fought was Evolution, which as it stands, is impossible to have occurred. Due to this joke of a theory proven wrong time and time again, and the fact it was blindly believed and considered "good science" and also the fact that Christianity fought it tooth and nail and rightfully so *breathe* leads to you people stereotyping them as "denying science" and "fighting against fact". It is ridiculous.

BTW, still haven't read any of what Bib had to say? Figuring so, as you guys still dodge his excellent argument.
 
This is like trying to reason with an eighty year old man, or a 5 year old child. No matter what the facts are, they will never concede and change their mind. So whats the point? Let them believe their religion. In a hundred years, i bet religion will almost die out. At least in the US. I wish an actual scientist was here, so they could blow all this creation crap outta the water. There is NO debate among most scientists about evolution. This is just politically motivated, religious dogma.

Religion fuels the support for Prez Bush. All his religious references and open religious crusades make people think he's sent by god. I heard a Bushie say to the Prez, "this is the 1st time I've felt like GOD is in the White House" and the crowd erupted in a standing appluase. How can you debate someone who thinks they are on god's side and your not? You cant win with that kind of stubborness. You cant compete with god, or what they think is god. Just look at LongTom's answer to #4 right above me. "You let God do it". Wow tom thats great for fantasy land, but this is real life. Hey god, I just got fired, can you get me a new job? Thanks, your the best god.

Oh and just curious, Sephin, how old are you and what part of the country do you come from?
 
sephin said:
The only "science" Christianity ever fought was Evolution, which as it stands, is impossible to have occurred. Due to this joke of a theory proven wrong time and time again, and the fact it was blindly believed and considered "good science" and also the fact that Christianity fought it tooth and nail and rightfully so *breathe* leads to you people stereotyping them as "denying science" and "fighting against fact". It is ridiculous.

Say this quote to any college science professor, and you will get laughed outta the room. Well any respectable college. Sure there are professors in Mississippi and Texas who still think that evolution didnt happen, and that the world is still flat.

All though you may not like it, we came from monkees. We were not made outta clay.
 
This is like trying to reason with an eighty year old man, or a 5 year old child. No matter what the facts are, they will never concede and change their mind. So whats the point? Let them believe their religion. In a hundred years, i bet religion will almost die out. At least in the US. I wish an actual scientist was here, so they could blow all this creation crap outta the water. There is NO debate among most scientists about evolution. This is just politically motivated, religious dogma.
Lol that is what everyone said when evolution came out. That is what they have been saying for the past 100 years. Technology is moving in. Science is growing. Therefor Christianity will die.

It has yet to happen. Religion will always be around. Since the beginning of time man has felt an innate search to find God. To find a greater purpose and a meaning for it all. God put that there, and it will always be there.

You say "actual scientist" like every "actual scientist" is a staunch believer in evolution and denies creation. You are arguing opinion because you refuse to, or cannot, deny the facts I am putting forward. Want to try a rudimentary logic debate? Christianity is true at the most simple and advanced levels of science and logic.

Time for me to throw back some stereotypes for fun. You are one of the non-religious kids who grew up, thinking religion is unfounded, brainwashing, and since you grew up hearing about evolution it is your only answer to the way things are.

You like to stereotype all Christians and religion, as Bible thumpers who will say everything is "miraculous" and every answer is "God works in mysterious ways", and you will sit there claiming how ignorant and close-minded Christians are, as you prove your hypocrisy. Hilarity as its best.

Religion fuels the support for Prez Bush. All his religious references and open religious crusades make people think he's sent by god. I heard a Bushie say to the Prez, "this is the 1st time I've felt like GOD is in the White House" and the crowd erupted in a standing appluase. How can you debate someone who thinks they are on god's side and your not? You cant win with that kind of stubborness. You cant compete with god, or what they think is god.
This has nothing to do with Bush lol. Nothing to do with the Beginning of the Universe or Christianity.

Just look at LongTom's answer to #4 right above me. "You let God do it". Wow tom thats great for fantasy land, but this is real life. Hey god, I just got fired, can you get me a new job? Thanks, your the best god.
You swear every answer from us is "miracle" or "God works in mysterious ways", but this IS one instance where God used his power to gather the animals. This is on thing we can't have evidence to directly prove, and thus it is the ONLY thing you will address.

The rest of the facts and science that we can back up you will skip over or call hogwash. Also when the facts we can't prove, we list as proof because the Bible says, you call us Bible thumpers and say the Bible is wrong. I dont blame you for that, in that small example. BUT if you consider the validity and complete perfection of the Bible, I find it perfect proof.

I find so many agnostics/atheists, who want to think of the world as grey, and if anyone wants to claim something as absolutely 100% correct, they will shoot it down without going any further. They wont look into it. They wont hear evidence for it.

They are the epitome of the stubborn hypocrite. You are doing exactly that. Now go read Bib's post and reply to it ;)
 
All though you may not like it, we came from monkees. We were not made outta clay.
Lol this is the easiest statement to refute. Come on, I am sure 5th graders learn to regulate on this, in Sunday School.

If evolution goes toward the most advanced form, and from Monkey to Man, Man is it.

Why are monkeys still around? Are some evolving at a slower rate? If so, where are the in between forms? The missing links never found?

The only "missing links" so far were either complete monkey, complete man, or it was a farce.

If monkeys (not monkees ;)) are still around today and so are humans, then so should the inbetween forms. Since they are not, this completely disproves the relation.
 
Evolution is about NATURAL SELECTION!!! They would not keep evolving unless their environment required them too!!

Like I said, go to any college science professor and have all that crap blown outta your head once and for all. End the brainwashing and learn some REAL stuff, not religous dogma. Try addressing the hard agruments laid forth by others like me, swank and ancient china.

You dont even know any scientific lingo, the "inbetween forms"?? Once again, how old are you, and what part of the country are you from? i only ask b/c it probably will explain alot.
 
Would you believe modern science was started by Christians to better under stand GOD?
Analogy (however you spell it the peeps who dig) was born to disprove the bible, over 25,000 times they went out things where right where the bible said they where, now the get their bibles out and read where to dig.
In Texas there is a place where their are human foot prints inside dino tracks.
as for 6000 years old I not sure I buy that but 6500 to10,000 years old I could.
Casey go to a micro biologist and ask him off the record his response might just knock you down.
 
Texan is right. My sister attends UCBerkeley (very liberal with very liberal professors). She is doing biochem engineering. She is in her 4th year and one of her chem teachers (not sure what kind of chem it was, but I can find out), called hydrogen "God's Atom" or "God's Hydrogen" (one of those two) because it is made so perfect.

In Hebrews it says
"By faith we understand that the worlds were prepared by the word of God, so that what is seen was not made out of things which are visible." Interesting...

The earth could be billions of years old. I find it funny that evolutionists keep adding time to how old the earth is, not based on dating, but based on the evolution model, so it is possible for their version of the beginning to occur and lead up to today. Talk about bad science.
 
Well, I've just gone through that rather large paper posted on the last page. All I can say is please read my above post about religion having to take scientific discovery and warp it around in order to fit it's claims. Anybody with a working knowledge of evolutionary science, biology, history, archeology, anthropology, really any of those disciplines will see some rather obvious problems. That being said, I'd need a note pad and about five cups of coffee to start listing them off, but if any of the pro-god folk would like to bring them out one on one for me I'd be happy to explain.

Or, as Casey has pointed out, what's the use? Let 'em believe, it doesn't hurt me any.

Here's a hypthetical situation though. We know life on earth has gone through something of the tune of 6 massive extinctions or castrophe periods. Say this happens again tomorrow, and very little life is left, but that whole evolution thing kicks in (even the most ardent god folk have to admit that evolution occurrs, no matter where you think life came from, even the Catholic church agrees with this) and some other sentient type of life becomes self aware enough to create language and culture, even religion. So will Jesus come back? I mean he is the guy right?

Or these things won't have souls right, even if they were equally intelligent as us? What if they believed they had some kind of soul? Is that it for God's involvement on planet earth since humans are gone? Will he just cook up a few more and start fresh? Seems like a waste eh? Of course if an extinction occurred it would be god's will right? And we can't understand god's will. We're not allowed, so don't bother to question anything that ever happens. It's just god's will. Geeze it's all so easy when you switch your brain off. Just don't question god or the bible, and claim that anything contrary to what the bible says is wrong or a lie despite evidence otherwise.

Rinse, and repeat.
 
Hey sephin, did you know we have about 98.5% of the same DNA as a chimpanzee? Well, probably you did, but think about it mate. No monkeys around right now are our direct ancestors, evolution doesn't work by one species jsut morphing into a new one over time and the old incarnation sudenly disappearing. Modern humans are the only humans around because our current form outcompeted and outsurvived all others. Just because we have primate origins doesn't mean those primates still exist, or that a currently existing monkey had to be one of our ancestors.

It's easy not believe in evolution when you don't understand the basic process, and don't try to tell me that you do, you clearly don't. You talk about evolving at a slower rate, as if there was a set rate of evolution or something. Evolution is simply biological changes that occurr over time in response to environmental change that makes certain traits more effective for survival. It isn't some kind of pre-programmed response or process, it just occurrs. You just revealed a whole lot about how much you actually understand, and as far as I am concerned have lost all credibilty in any debate in which science, and especially evolution, is even a factor.
 
Last edited:
Swank most Christion belive in mirco evolution not macro-evolution. We belive 2 dogs got off the arc we don't belive 500 breeds of dogs jumped out from under a rock.
 
Well, I've just gone through that rather large paper posted on the last page. All I can say is please read my above post about religion having to take scientific discovery and warp it around in order to fit it's claims. Anybody with a working knowledge of evolutionary science, biology, history, archeology, anthropology, really any of those disciplines will see some rather obvious problems. That being said, I'd need a note pad and about five cups of coffee to start listing them off, but if any of the pro-god folk would like to bring them out one on one for me I'd be happy to explain.
Bib brought them up. Are you going to address his claims?

Here's a hypthetical situation though. We know life on earth has gone through something of the tune of 6 massive extinctions or castrophe periods. Say this happens again tomorrow, and very little life is left, but that whole evolution thing kicks in (even the most ardent god folk have to admit that evolution occurrs, no matter where you think life came from, even the Catholic church agrees with this) and some other sentient type of life becomes self aware enough to create language and culture, even religion. So will Jesus come back? I mean he is the guy right?
Yes we all agree in microevolution (within species). Not that one single cell organism, over time evolved into what we are today. It is a mathematical impossibility, even in billions of years.

Your hypothetical situation will not happen according to the Bible. The next time the whole earth suffers a complete wipeout will be in fire, as it says in Revelations. If this mass extinction like you said occurs though, of course the Bible is wrong, and since one part is wrong I would disregard the whole thing. But then again, by then Id be dead :(

Or these things won't have souls right, even if they were equally intelligent as us? What if they believed they had some kind of soul? Is that it for God's involvement on planet earth since humans are gone? Will he just cook up a few more and start fresh? Seems like a waste eh? Of course if an extinction occurred it would be god's will right? And we can't understand god's will. We're not allowed, so don't bother to question anything that ever happens. It's just god's will. Geeze it's all so easy when you switch your brain off. Just don't question god or the bible, and claim that anything contrary to what the bible says is wrong or a lie despite evidence otherwise.

Rinse, and repeat.
Like I said, we know God's will about mass extinction by reading Revelation ;) I love when people expound on assumptions and hypotheticals.

You might not know God's exact will, but you can know God's heart (overall intentions), and you can read the Bible to figure most of it out.

Show me the evidence discrediting the Bible. Please do. I am always open to hear evidence refuting the Bible. Funny how the most popular things thrown at Christiniaty are the most absurd (aka The Da Vinci Code).

Hey sephin, did you know we have about 98.5% of the same DNA as a chimpanzee? Well, probably you did, but think about it mate. No monkeys around right now are our direct ancestors, evolution doesn't work by one species jsut morphing into a new one over time and the old incarnation sudenly disappearing. Modern humans are the only humans around because our current form outcompeted and outsurvived all others. Just because we have primate origins doesn't mean those primates still exist, or that a currently existing monkey had to be one of our ancestors.
I know about the % of DNA. Only thing you have done with this is turned the spotlight towards the fossil record. No missing links found yet. Maybe one day ;)

It's easy not believe in evolution when you don't understand the basic process, and don't try to tell me that you do, you clearly don't. You talk about evolving at a slower rate, as if there was a set rate of evolution or something. Evolution is simply biological changes that occurr over time in response to environmental change that makes certain traits more effective for survival. It isn't some kind of pre-programmed response or process, it just occurrs. You just revealed a whole lot about how much you actually understand, and as far as I am concerned have lost all credibilty in any debate in which science, and especially evolution, is even a factor.
Lol you are very funny my friend. I never said evolution was a set a time. Good taking what I say out of context in one sentence and spending the rest expounding on that ;)
 
BTW Richard Deem is the man. http://www.freerepublic.com/forum/a3b47d7b94f92.htm

Awesome read. Yet another intelligent writer slapping evolution in the face.

Descent of Man Theory: Disproved by Molecular Biology
by Richard Deem
Introduction
The current theory of human evolution states that modern humans evolved from more primitive bipedal hominids. The first bipedal hominid genus that is supposedly the ancestor of modern humans is Australopithecus, which appeared in the fossil record from about 4.4 to 1 million years ago throughout eastern Africa. Australopithecus comprised a diverse group of small-brained bipedal species that were confined to the savannas of Africa. This genus was supposed to have evolved into the genus Homo, which has been defined as bipedal primates with a brain capacity over 700 cc, having appeared in the fossil record by about 2 million years ago as Homo habilis in eastern Africa. According to theory, Homo habilis evolved into Homo erectus, which had a brain capacity just over 1000 cc, appearing in the fossil record from about 1.5 million to 300 thousand years ago. Homo neandertalensis lived between 400 and 28 thousand years ago. Archaic Homo sapiens appeared 400 - 150 thousand years ago, and modern Homo sapiens from less than 100 thousand years ago. Contrary to the claims of many creationists, there is ample evidence for the existence of human-like species of bipedal primates. The dates and ages of these fossils are not widely disputed in scientific circles. The reality of the fossil record and the reliability of the dates of these fossils is actually instrumental in disproving the descent of man theory. If the fossil record were not as complete as it now is, the standard evolutionist argument would apply, "we just haven't found the missing link ancestor of modern humans yet."

The beginning of trouble - lack of genetic diversity among modern humans
As evolutionists studied humans and species of apes in the 1970's and 1980's, some rather surprising information was being discovered that distinguished us from apes and other primates. The maximum Fst value (a measure of variation between population groups) between human races is 0.08 (1, 2). However, among populations of chimps, orangutans, and other primate species, Fst values are commonly more than 0.20. An examination of 62 common protein coding genetic loci, indicates a substitution rate of 0.011/locus (Caucasoids versus Mongoloids), to a maximum of 0.029 (Mongoloids versus Negroids). However, in nearly all other animal species studied, including apes, usually exceed 0.05 (2). In humans, heterozygosity (the proportion of alleles that are polymorphic, in this case within the species) is 1.8% , whereas in apes it ranges from 2.5 in the Orangutan to 3.9 in the Chimpanzee (3). An analysis of the genetics of populations of apes reveals that different population groups possess fixed novel mutations that characterize each population. In contrast, there are no novel mutations or genetic alleles that specifically characterize any one human race from another. More recent studies have confirmed the early work, likewise showing that human genetic diversity is far less than what one would predict from Darwinian theory. Dr. Maryellen Ruvolo (Harvard University) has noted, "It's a mystery none of us can explain." (4). Examinations of the genetic sequences of diverse modern human populations reveals minor, if any differences (5). All of this evidence suggested a recent origin for modern humans.

Still more trouble - Discontinuous morphological changes in the hominid lineage
Paleontological discoveries and geochronology show that the pattern of morphological change in the hominid fossil record was not progressive, but abrupt (6). Some adaptations essential to bipedalism appeared early, but others appeared much later. Although the 3.2 million year old fossil "Lucy" (Australopithecus afarensis), was said to be bipedal, her 2.6 million year old descendent, Australopithecus africanus, was indisputably arboreal (7). Primitive craniodental complexes (similar to the reconstructed last common ancestor with the African great apes) were found in nearly all species of Hominidae (8). Relative brain size increased slightly among successively younger species of Australopithecines, although many Australopithecine skulls have brain capacities no larger than those of chimpanzees. (9, 10). However, brain capacities expanded abruptly with the appearance of Homo, but within early Homo remained at about half the size of Homo sapiens for almost a million years. The fossil record indicates an accumulation of relatively rapid shifts in successive species, and certainly not any kind of gradualistic changes.

Another problem - too many deleterious mutations
A recent study examined the mutation rate for humans. Using "conservative assumptions" the authors found that the overall mutation rates was 4.2 mutations per person per generation, with a deleterious rate of 1.6 (11). When using more realistic assumptions the overall mutation rate for humans become 6.7 with a deleterious rate of 3.1. Such a high rate should have resulted in extinction of our species long ago. They stated in their conclusion:

"The deleterious mutation rate appears to be so high in humans and our close relatives that it is doubtful that such species, which have low reproductive rates, could survive if mutational effects on fitness were to combine in a multiplicative way."

The authors had to rely upon a rare association of mutations, termed synergistic epistasis to explain why the numerous hypothesized deleterious mutations have not overwhelmed our genome. Instead of postulating the obvious (that the human genome is not as old as evolution would teach), evolutionists must rely upon the improbable to retain the evolutionary paradigm.

Recent origin of modern humans confirmed through molecular biology
Mitochondrial DNA (mtDNA)
In the late 1980's and early 1990's a number of studies were done examining the mitochondrial DNA (mtDNA) of women all over the world. These studies, nicknamed the "Eve theory," suggested that the last common ancestor of modern man (actually women) appeared within the last 200,000 years (12-15), much more recently than previously thought. Refinements in the measurements lowered the original estimates to 135,000 years (15) and finally 100,000 years (19). Scientists chose to examine mtDNA because, being enclosed within the subcellular organelle called the mitochondrion, there is no genetic recombination (males make no contribution of mtDNA to the fetus). All mtDNA comes from our mothers and is passed down from mother to daughter, since only mitochondria from the egg are used to make up the fetus. By tracing the differences in mtDNA from peoples around the world, scientists have calculated the probable date of the last common ancestor of modern humans at 100,000 to 200,000 years ago.

Y-chromosome analysis
In 1995, scientists have examined human origins from the perspective of male genetics (16, 17). Scientists have examined a gene (ZFY), which being on the Y chromosome, is passed down only from father to son. Thirty-eight men were chosen from all over the world (Africa, Asia, Australia, Europe, and Northern, Central, and South America). Scientists determined the actual genetic sequence in each man for this gene, which is 729 base pairs long. To their surprise, all men had identical genetic sequences (over 27,000 base pairs analyzed). Scientists have calculated the most probable date for the last common ancestor of modern man, given the sequence diversity from modern apes. Using two different models this date is either 270,000 or 27,000 years ago. However, both these models assume that the male population during this entire period of time consisted of only 7,500 individuals. The date estimates from these models would be significantly reduced if the male population were higher than 7,500, which is very likely. Two separate studies using similar techniques looked at larger pieces of the Y chromosome, which would reduce the uncertainty in the calculation of dates. One study examined a gene which was 2,600 base pairs and determined a last common ancestor date of 188,000 year ago (minimum of 51,000 and maximum of 411,000 years ago) (18). The other study used a very large piece of the Y chromosome (18,300 base pairs) and calculated a last common ancestor date of modern man of 43,000 years ago (minimum of 37,000 and maximum of 49,000 years ago) (19). This latter study also examined mitochondrial DNA from women and determined an origination date of 90,000-120,000 years ago.

Linkage disequilibrium analysis
A studied published in 1996 (20) examined linkage disequilibrium at the human CD4 locus (a T-cell associated antigen) as a means to establish the date of modern human origins. This study determined a maximum origin date of 102,000 years ago based upon the assumption that the Alu (-) allele arose 5 million years ago, or almost immediately after mankind's split from other primates. As they stated, "It is likely that the Alu deletion event occurred more recently, in which case our estimates for the date of founding of the non-African populations would also be more recent." Preliminary studies from chromosomes 19, 11 and 8 show similar results to that seen on chromosome 12 (the locus of the CD4 gene) (21).

Using rare mutations to estimate population divergence times
A study published in December, 1998 examined population divergence time using rare mutations between populations to estimate divergence among three Mediterranean populations. The results indicated that Danish people (who are my ancestors) would have diverged from the other groups, at most, 4,500 to 15,000 years ago (22). This number does not necessarily help us establish a date for the appearance of modern humans, but it is likely that future studies in this area (this is one of the first published) may provide accurate numbers for the appearance of human populations in different areas of the world and a lower limit to the date of appearance of modern humans.

The nail in the coffin
Therefore, the most accurate date (see note below) for the origin of modern humans indicate that the last common ancestor to modern humans must have existed less than 50,000 years ago (19). Such a recent date left only one potential ancestor for modern humans, that is, Homo neandertalensis (Neanderthals), which lived between 400,000 and 28,000 years ago. Previous anatomical studies had cast doubt on the possibility of Neanderthals being the ancestors of modern humans (23-26). These studies showed differences in Neanderthal's brain case (23) and the presence of an internal nasal margin, a medial swelling of the lateral nasal wall, and a lack of an ossified roof over the lacrimal groove (24-25). None of these features are found in Homo Sapiens, and the last feature is not found in any other terrestrial mammal! Neanderthals had a huge nasal cavity coupled with a brain size larger than our own. However, with their carnivorous lifestyle, it seems likely that much of their brain might have been devoted to the sense of smell, being the "dog" among the hominids.

In brilliantly designed and executed independent studies, scientists have extracted mtDNA from three Neanderthal skeletons; one from Neander Valley in Germany, another from the northern Caucasus near the Black Sea, and the third in Vindija Cave, Croatia, and laid to rest any question of whether Neanderthals could have been our ancestors (27, 28, 29). The first study examined a 397 base pair Neanderthal mtDNA fragment and compared it with a mtDNA sequence of 986 nucleotide pairs from living humans of diverse ethnic backgrounds. The results (Table 1) showed an enormous 26 nucleotide base pair difference between the Neanderthal and Human mtDNA (a 6.5% difference) (30). In this region of the mtDNA, modern humans differ from one another in an average of eight base pairs, and those differences were completely independent of the 26 observed for the Neanderthal fossil. However, many of the sequence variations found in the Neanderthals were shared in the Chimpanzee. A 357 base pair sequence of mtDNA was examined from the second Neanderthal fossil and was found to vary from modern human sequences at 23 bases (6.4%), nineteen of which were identical to those of the first Neanderthal. The third Neanderthal differed from modern humans by 26 bases, 23 of which matched the first Neanderthal and 20 of which matched the second specimen. A summary of the findings of the two studies can be found in Table 1, below.

Table 1. Sequence Differences* Between Modern Humans and Neanderthals
mtDNA Sample
(HVR-1) Sequence Number (Read Down)
111111111111111111111111111111111
666666666666666666666666666666666
000011111111111112222222222223333
378900112345568880233455666791246
786378129984692399304468123891042

Modern Human AATTCCCCGACTGCAATTCACGCACC-CATCCT
Chimpanzee ......T.ATT.....ACTGAAA.....G....
Neanderthal #1 GG.CTTTTATTC.T.CCCTGTAAG.TATGCT.C
Neanderthal #2 .C.....ATT.ATCCCCTGTAA..TATGCTTC
Neanderthal #3 GG......ATTC.TCCCCTGTAAG.TATGCT.C
*mtDNA HVR-1

The analysis of the second sample was extremely important, since it was dated at 29,000 years ago - only 1000 years before the last Neanderthal disappeared (31). If Neanderthals and humans had interbred, one should have expected to see this in the last remnants of the Neanderthals. In addition, since the Neanderthal fossils were separated geographically by over 2,500 km, it shows that Neanderthals were a homogeneous species. The researchers conclusion: "Neanderthals were not our ancestors" - a quote from the authors of the first study. In fact, the differences between modern humans and Neanderthals were so great that calculations indicated that the last common ancestor (according to evolutionary theory) must have existed 550,000 to 690,000 years ago (first study) and 365,000 to 853,000 years ago (second study).

Although the differences between modern humans and Neanderthals are large, the differences among individual humans or among individual Neanderthals is small compared to other apes (Table 2). Such low genetic diversity among Neanderthals are consistent with a creation model in which Neanderthals were specially created as a small population in the relatively recent past. The much larger variation seen among chimpanzees and gorillas does not eliminate them as specially created, but does place their probable creation date considerably before that of modern humans.

Table 2. mtDNA Sequence Variation Among Species (29) Population Individuals Mean Minimum Maximum s.d.
Neanderthals 0,003 03.73 - - -
Humans 5,530 03.43 0.00 10.16 1.21
Chimpanzees 0,359 14.81 0.00 29.06 5.70
Gorillas 0,028 18.57 0.40 28.79 5.26

Ancient Anatomically Modern Humans - the missing evidence
Knowing the variation of sequences between modern humans and Neanderthals is important in determining if Neanderthals contributed to the human gene pool. However, without a measure of the variation among ancient anatomically modern humans and between them and modern humans, the data is incomplete. The first of these studies was published in 2001, examining the mtDNA sequences of 10 ancient Australians (32). A summary of the HVR-1 sequence of these individuals (compared with the modern human reference sequence, modern Aboriginal polymorphism, Neanderthals, and chimpanzees) can be found in Table 3, below. The first thing that one notices is that the sequence variation of ancient humans compared to modern humans is at most 10 base pairs (in LM3, the most ancient specimen). As stated previously, the average variation among population groups of modern humans is 8 base pairs. LM3, dated at 62,000 years old, varied the most from the modern human reference sequence, but this variation included only three bases shared with Neanderthal specimens. Since LM3 was a contemporary (or lived even earlier than the Neanderthals sequenced to date), it is apparent that the human genome was already nearly "modern" before Neanderthals died out. The authors of the study made a big deal about the LM3 sequence sharing similarity to a portion of chromosome 11 in modern humans (thought to have been inserted into the human genome from the mtDNA). The authors concluded that the "loss" of the ancient mtDNA variation seen in LM3 could explain how Neanderthals do not share mtDNA with modern humans. Although it is certainly possible that part of mtDNA might find its way into the nuclear genome, it doesn't address the issue of how the variation seen in the mtDNA of LM3 was "lost." In fact, of the ten sequence differences between LM3 and the modern human reference sequence, five of those bases correspond to polymorphisms found in modern Aboriginal people, showing that those five bases were not lost at all. This leaves only a five base difference, certainly within the range of that found among modern humans. Overall, the lack of "evolution" for humans over the last 60,000 years stands in sharp contrast to the large differences seen between modern humans and Neanderthals. European evolutionists have also disputed the claims of Adcock et al. in the journal Science in June, 2001. More information on this can be found in the paper, New DNA Evidence Supports Multiregional Evolutionary Model?

Table 3. mtDNA Sequence Variation of Ancient, Anatomically Modern Humans (32) mtDNA Sample
(HVR-1) Age
(ka) Sequence Number (Read Down)
00111111111111111222222222222222222222222222233333333333333
79001122345668889001223344444555566677888899901112345556688
83781269984393499198340413479368923448467803911780715672817

Modern Human 0 ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA
Aboriginal 0 ......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C...
Bonobo 0 ......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC..
Chimpanzee 0 ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C..
Neanderthal #1 30+ GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C...
LM3 62 ....................T.G...........CT.T....T..T......TC....G
LM4 <10 .................T...........G................C............
LM15 0.2 ....................T........................T.......C....G
LM55 <10 ...........G.......................T.......................
KS1 10 .C............T.....T.........................CG..T........
KS7 8 ..............T.....T..................T...........C.......
KS8 8-15 ....................T.G..............TG.......C............
KS9 9 .C..................T..............T............C.........G
KS13 8-15 .C............T.....T....C.G.................TC............
KS16 9-15 ....................T...................T.............C..C.
*mtDNA HVR-1



The bottom line
There are two currently popular theories of human evolution 1) a single recent appearance of modern humans and 2) the multiregional model, which states that modern humans evolved simultaneously on different continents. Molecular biology destroys the multiregional model (12-22, 27-32). In addition, even the fossil evidence does not support the multiregional model (33). Instead, all the data supports the biblical view that humanity arose in one geographical locale. Modern molecular biology tells us that modern humans arose less than 100,000 years ago (confirmed by three independent techniques), and most likely, less than 50,000 years ago (12-22). This data ties in quite well with the fossil record. Sophisticated works of art first appear in the fossil record about 40,000-50,000 years ago (34) and evidence of religious expression appears only 25,000-50,000 years ago (35, 36). Other indications of rapid changes during the Middle-Upper Paleolithic transition (35, 000 to 45, 000 years ago) in Europe include (37):

A shift in stone tool technology from predominantly "Rake" technologies to "blade" technologies, achieved by means of more economic techniques of core preparation.
A simultaneous increase in the variety and complexity of stone tools involving more standardization of shape and a higher degree of "imposed form" in the various stages of production.
The appearance of relatively complex and extensively shaped bone, antler, and ivory artifacts.
An increase in the rate of technological change accompanied by increased regional diversification of tool, forms.
The appearance of beads, pendants, and other personal ornaments made from teeth, shell, bone, stone, and ivory blanks.
The appearance of sophisticated and highly complex forms of representational or "naturalistic" art.
Associated changes in the socioeconomic organization of human groups, marked by
a more specialized pattern of animal exploitation, based on systematic hunting
a sharp increase in the overall density of human population
an increase in the maximum size of local residential groups
the appearance of more highly "structured" sites, including more evidence for hearths, pits, huts, tents, and other habitations.
Simultaneous, rapid changes in human abilities suggest replacement of previously existing hominids with modern humans. The fact that all these events happened ~50,000 years ago precludes any possibility that previously existing hominids could be our ancestors, since Homo erectus died out 300,000 years ago, and Homo neandertalensis has been proven to be too genetically different from us to have been our ancestor (27, 28). Where does this leave the evolutionists and their descent of man theory? Well, they can always fall back on their favorite line - "the fossil record is just incomplete." Alternatively, check out Genesis 1:26.


--------------------------------------------------------------------------------

References
R. Lewontin 1972. The apportionment of human diversity. Evolutionary Biology 6: 381-398
M. Nei and A. K. Roychoudhury. 1982. Genetic relationship and evolution of human races. Evolutionary Biology 14: 1-59
Janczewski DN. Goldman D. O'Brien SJ. 1990. Molecular genetic divergence of orangutan (Pongo pygmaeus) subspecies based on isozyme and two-dimensional gel electrophoresis. Journal of Heredity 81: 375-387
Gibbons, A. 1995. The mystery of humanity's missing mutations. Science 267: 35-36.
Pult I, Sajantila A, Simanainen J, Georgiev O, Schaffner W, Paabo S. 1994. Mitochondrial DNA sequences from Switzerland reveal striking homogeneity of European populations. Biol Chem Hoppe Seyler 375: 837-840
Wood B. 1992. Origin and evolution of the genus Homo. Nature 355: 783-790.
Shreeve, J. 1996. New skeleton gives path from trees to ground an odd turn. Science 272: 654
McHenry H.M. 1994. Body size and proportions in early hominids. Proceedings of the National Academy of Sciences of the United States of America 91: 6780-6786.
Dean Falk. 1998. Hominid brain evolution: looks can be deceiving. Science 280: 1714
Conroy, G.C., G.W. Weber, H. Seidler, P.V. Tobias, A. Kane, and B. Brunsden. 1998. Endocranial capacity in an early hominid cranium from Sterkfontein, South Africa. Science 280: 1730-1731.
Eyre-Walker, A. & Keightley, P. D. 1999. High genomic deleterious mutation rates in hominids. Nature 397, 344-347.
R.L. Cann, M. Stoneking, A.C. Wilson. 1987. Mitochondrial DNA and human evolution. Nature 325: 31.
L. Vigilant, M. Stoneking, A.C. Harpending, K. Hawkes, A.C. Wilson. 1991. African populations and the evolution of human mitochondrial DNA. Science 253: 1503.
M. Hasegawa, S. Horai. 1991. Time of the deepest root for polymorphism in human mitochondrial DNA. J. Mol. Evol. 32: 37.
Stoneking M, Sherry ST, Redd AJ, Vigilant L. 1992. New approaches to dating suggest a recent age for the human mtDNA ancestor. Philos. Trans. R. Soc. Lond. B Biol. Sci. 337: 167-175.
S. Paabo. 1995. The Y chromosome and the origin of all of us (men). Science 268: 1141.
R.L. Dorit, H. Akashi, W. Gilbert. 1995. Absence of polymorphism at the ZFY locus on the human Y chromosome. Science 268: 1183.
Hammer, M.F. 1995. A recent common ancestry for human Y chromosomes. Nature 378: 376-378.
Whitfield, L.S., J.E. Suston, and P.N. Goodfellow. 1995. Sequence variation of the human Y chromosome. Nature 378: 379-380.
Tishkoff, S.A., E. Dietzsch, W. Speed, A.J. Pakstis, J.R. Kidd, K. Cheung, B. Bonn-Tamir, A.S. Santachiara-Benerecetti, P. Moral, M. Krings, S. Paabo, E. Watson, N. Risch, T. Jenkins, and K.K. Kidd. 1996. Global patterns of linkage disequilibrium at the CD4 locus and modern human origins. Science 271: 1380-1387.
FiscHydromaxan, J. 1996. Evidence mounts for our African origins - and alternatives. Science 271: 1364.
G. and B. Rannala. 1998. Using rare mutations to estimate population divergence times: A maximum likelihood approach. Proceedings of the National Academy of Science USA 95: 15452-15457.
Seidler H, Falk D, Stringer C, Wilfing H, Muller GB, zur Nedden D, Weber GW, Reicheis W, and Arsuaga JL. 1997. A comparative study of stereolithographically modeled skulls of Petralona and Broken Hill: implications for future studies of middle Pleistocene hominid evolution. J. Hum. Evol. 33:691-703.
Schwartz, J.A. and I. Tattersall. 1996. Significance of some previously unaccompanied apomorphies in the nasal region of Homo neandertalensis. Proceedings of the National Academy of Science USA 93: 10852-10854.
Laitman, J.T., J.S. Reidenberg, S. Marquez, and P. J. Gannon. 1996. What the nose knows: New understandings of Neanderthal upper respiratory tract specializations. Proceedings of the National Academy of Science USA 93: 10543-10545.
Holden, C. 1999. A New Look Into Neandertals' Noses. Science 285: 31-33.
Krings, M., A. Stone, R. W. ScHydromaxitz, H. Krainitzki, M. Stoneking, and S. Paabo. 1997. Neandertal DNA Sequences and the Origin of Modern Humans. Cell 90: 19-30.
Igor V. Ovchinnikov, I.V., A. Gotherstrom, G. P. Romanovak, V. M. Kharitonov, K. Liden, and W. Goodwin. 2000. Molecular analysis of Neanderthal DNA from the northern Caucasus. Nature 404: 490-493.
Krings, M., C. Capelli, F. Tschentscher, H. Geisert, S. Meyer, A. von Haeseler, K. GrossscHydromaxidt, G. Possnert, M. Paunovic, and S. P””bo. 2000. A view of Neandertal genetic diversity Nature Genetics 26: 144-146.
Arnason, U., X. Xu, and A.Gullberg. 1996. Comparison between the complete mitochondrial DNA sequences of Homo and the common chimpanzee based on nonchimeric sequences. J. Mol. Evol. 42: 145-52.
Stringer, C. B. and R. Mackie. 1996. African Exodus: the Origin of Modern Humanity. Cape, London.
Adcock, G.J., E.S. Dennis, S. Easteal, G.A. Huttley, L.S. Jermiin, W.J. Peacock, and A. Thorne. 2001. Mitochondrial DNA sequences in ancient Australians: Implications for modern human origins. Proceedings of the National Academy of Science USA 98: 537-542
Foley R. 1998. The context of human genetic evolution. Genome Res 8:339-347.
Klein, R.G. 1992. Evolutionary Anthropology 1: 5-14.
Balter, M. 1999. Restorers reveal 28,000-year-old artworks. Science 283: 1835.
Simon, C. 1981. Stone-age sanctuary, oldest known shrine, discovered in Spain. Science News 120: 357.
Bower, B. 1986. When the human spirit soared. Science News 130: 378-379.
Clark, G.A. 1999. Highly visible, curiously intangible. Science 283: 2029-2032.

--------------------------------------------------------------------------------

Note:
The 50,000 year date is the best estimate for modern human origins because the study used a much larger nucleotide base pair sample size, resulting in a much less uncertainty in the date generated (see the table below for further explanation).

95% confidence interval
Study Model # base pairs # men Total base pairs Lower Upper Mean Male population size
Dorit, et al. Coalescent 729 38 27702 0 800,000 270,000 7,500
Dorit, et al. Star phylogeny 729 38 27702 0 80,000 27,000 7,500
Hammer Coalescent 2,600 15 39,000 51,000 411,000 188,000 5,000
Whitfield, et al. Coalescent 18,300 5 91,500 37,000 49,000 43,000 not given
The estimate of modern origins is highly dependent upon the assumed population size (last column of table). The first study assumed a male population size of 7,500 individuals for the entire period of humanity (excluding the last couple thousand years, of course). Such a population size, according to the authors, is "an exceedingly small population size for this entire 300,000 year period" (16). However, such as small population size was necessary to make the coalescence time as large as it was. Hammer used an even smaller population size (5,000), since he was concerned that his study would not be accepted if the coalescence time was too small (which he admitted to doing in Internet dialogs). The first two studies (Dorit, et al. and Hammer) have very large confidence intervals, due to the small number of nucleotide base pairs analyzed. Given the size of the confidence intervals in the first two studies, the numbers from all three studies are basically the same. Obviously, the Whitfield, et al. gives the most precise estimate of the date for the appearance of modern humans.
 
Do you think dodging all the facts I have presented, long-winded or not does anything for you ;)?

You simply refuse to even read anything I put forth. You might pick out 1-2 quotes you can misquote or go off on, getting away from the main debate. *shrug* I'm done here. The Bib and Deem articles are where the facts are at, and you dodge both.

Ah well. Did my best, but you cant reason with people that refuse to look at the logic. As many of these threads go. My opposition posts little facts and when they do many have little relation to the topic. Have fun with all your opinions ;)
 
Sephin - your whole post leads me to believe that you don't understand a bloody thing about evolution:

**Lol this is the easiest statement to refute. Come on, I am sure 5th graders learn to regulate on this, in Sunday School.

If evolution goes toward the most advanced form, and from Monkey to Man, Man is it.

Why are monkeys still around? Are some evolving at a slower rate? If so, where are the in between forms? The missing links never found?

The only "missing links" so far were either complete monkey, complete man, or it was a farce.

If monkeys (not monkees ) are still around today and so are humans, then so should the inbetween forms. Since they are not, this completely disproves the relation. **

Evolution does not favor the most advanced form, only change. Complexity is not a dependent in the evolutionary process. Evolution favors whatever works best in the species environment - not complexity. This is fundamental to the theory and clearly beyond you.

Why are monkies still around? Are you nuts? Why wouldn't they be around? Because we are around all types of primates ought to be extinct? Once again, you have demonstrated with amazing gusto that you have absolutely no actual understanding of evolutionary theory.

No missing links? Ever hear of Lucy? There are tons of fossils of creatures that are neither strictly apre nor man, and more continue to be found. This whole 'there is no missing link' argument is hilarious. What will satisfy you people? Here's a question, how many times can you split an angle - it's rechinically infinate. How man more skeletons that are neither modern homosapien nor more primitive ape to anthropoligsts have to find and show you people before you realize there are middling life forms between modern human and ape?

I'm really chuckling over here . . . you can't be argued with my friend - why should I even discuss something with you that you don't have any basic understanding of in the first place?
 
So god created earth and created us in his own image... So then howcome god made dinosaurs first? was he saving the best for last?

I want dinosaurs back they were cool looking.
 
Imagine dinosaurs living with humans today.. man oh man.

George bush mounting a couple guns on a T-Rex and strolling into IRAQ.. HAHAHAHA
 
General chit-chat
Help Users
Do be patient when you're sending private chats to one another. Most brothers don't use the chat function. They prefer to post inside the general forum instead:

https://mattersofsize.com/forums/penis-enlargement-forum.19/

Come and join us there.
  • No one is chatting at the moment.
  • MoS Notifier MoS Notifier:
    Jestyn is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    BarryPipener is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    Barker8 is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    anonymous180 is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    Daddyeric69 is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    Dosh1976 is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    Pedick is our newest member. Welcome!
  • D @ disonefx:
    How do people use the silistretcher during the day while they're being active, like getting up and down from the seated position? How doesit work
    Quote
  • MoS Notifier MoS Notifier:
    Nyzz is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    Mitolyn is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    Honeytrick is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    rockhopper is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    Aaron1664 is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    StevenHanks is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    JCHall is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    jmon0084 is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    Eagle060101 is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    Moraesszx is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    nnewsjune is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    hobroip is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    NM15 is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    Tachikj is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    thinkingaboutit14 is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    Mitolynnew is our newest member. Welcome!
  • MoS Notifier MoS Notifier:
    roro is our newest member. Welcome!
      MoS Notifier MoS Notifier: roro is our newest member. Welcome!
      Back
      Top